Labshake search
Citations for Promega :
351 - 400 of 4791 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... on a Glomax Discovery plate reader (Promega). 48hr after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting cDNA was analyzed by RT-qPCR using SYBR green fluorescent dye 2x qPCR master mix (Promega) in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... The resulting cDNA was analyzed by RT-qPCR using SYBR green fluorescent dye 2x qPCR master mix (Promega) in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and from the interior tissue (at least 2 mm away from the outermost edge of the specimen) using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: Approximately 6 × 107 control cells and 2 × 107 sort2 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (A1125, Promega). Approximately 325 μg of genomic DNA from control cells and 60 μg of genomic DNA from sort2 cells were used for amplification of gRNA ...
-
bioRxiv - Genomics 2021Quote: ... Tris(2-carboxyethyl)phosphine (TCEP) and BCA protein assay kit were from Pierce and sequence-grade trypsin was from Promega. Rapigest and Sep-Pak C18 columns were from Waters and C18 Zip tips were from Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was then synthesized using 2 μg of mRNA and a Transcriptase first-strand cDNA synthesis kit (Promega, Madison, WI). Real-Time qPCR to detect the indicated targets was performed on a LightCycler® 480 System (Roche Life Science ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... Once all reactions had been set up the plate was moved to a GloMax® Explorer plate reader (Promega) and incubated for 40 min at 25 °C before reading for luminescence ...
-
bioRxiv - Microbiology 2020Quote: ... GFP fluorescence was measured in triplicate 200 μl volumes in a 96 well plate using GloMax plate reader (Promega). E ...
-
bioRxiv - Molecular Biology 2020Quote: Luciferase results were collected 48 hours post-transfection on a GloMax-Multi+ Detection System (Promega, E7081) using the Promega Dual-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subjected to RNA interference efficiency detection by using a dual-luciferase reporter system (Promega, USA). The shRNA with most efficient RNA interference efficiency then was selected for generation of BMP15 knockdown pig model.
-
bioRxiv - Developmental Biology 2019Quote: ... RT-qPCR was performed with GoTaq® qPCR Master Mix for Dye-Based Detection (Promega, A6001) using a CFX Connect Bio-Rad qPCR System ...
-
bioRxiv - Genomics 2019Quote: ... Detection of pull-down product was performed with qPCR using GoTaq® qPCR Master Mix (Promega) and target specific primers (Supplementary Table 5).
-
bioRxiv - Microbiology 2020Quote: ... RL activity was measured at the indicated times using a GloMax-Multi Plus Detection System (Promega). The effect of the peptide on membrane fusion activity was evaluated by the DSP assay ...
-
bioRxiv - Cell Biology 2022Quote: ... the samples were mixed in a 1:1 (v/v) ratio with nucleotide detection reagent (Promega) in a 96-well white opaque plate and left at room temperature in the dark for another 60 minutes ...
-
bioRxiv - Genomics 2021Quote: ... Firefly luciferase and Renilla luciferase signals were sequentially measured on a GloMax Multi Detection System (Promega). Signal integration time was set to one second per well ...
-
bioRxiv - Immunology 2020Quote: ... Firefly luciferase activity was measured using BrightGlo luciferase reagent on a GloMax-Multi+ Detection System (Promega). Pseudovirus neutralisation titres (ND50 ...
-
bioRxiv - Plant Biology 2023Quote: ... emission wavelength MU: 455 nm) using a fluorometer (Glomax-Multi+ Detection System with InstinctR Software, Promega). The promoter activity was determined by calculating the relative LUC/GUS ratio.
-
bioRxiv - Neuroscience 2022Quote: ... and luciferase activity was measured in triplicate by the GloMax® Multi Detection System apparatus (Promega) using the Dual-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: Two assays were used for detection of ATP hydrolysis: The ADP-Glo assay (Promega, Cat#V6930), which detects ADP ...
-
bioRxiv - Molecular Biology 2023Quote: FLAG-tagged SPUD in vitro expression was done with Transcend Non-Radioactive Translation Detection System (Promega) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The optical density at 450 nm was determined on a GloMax®-Multi Detection System (Promega).
-
bioRxiv - Synthetic Biology 2023Quote: ... Protein was quantified using the Nano-Glo® HiBiT Extracellular Detection System (N2420, Promega, Madison, WI) using the HiBiT Control Protein (20 µM ...
-
bioRxiv - Plant Biology 2023Quote: ... were used for fluorometric detection of the immune-reactive bands with the AttoPhos system (Promega, USA). The fluorescence signal was visualized with a ChemiDoc™ MP imaging system (Biorad ...
-
bioRxiv - Microbiology 2023Quote: ... the HiBiT value was measured using the Nano Glo HiBiT Lytic Detection System (Promega, Cat# N3040) as described previously [22].
-
bioRxiv - Synthetic Biology 2023Quote: Translation yield from the PURExpress reactions was quantified using Nano-Glo HiBiT Extracellular Detection System (Promega). To make 1X NanoGlo solution ...
-
bioRxiv - Pathology 2021Quote: ... The DNA concentration of each PCR product was determined using a QuantiFluor™-ST fluorescent quantitative system (Promega, USA), and mixed with the appropriate proportion based on sequencing requirements ...
-
bioRxiv - Biophysics 2023Quote: ... we normalized the luminescent signal to the fluorescent signal obtained with CellTiter-Fluor® Cell Viability assay (G6082, Promega). The signals were detected with Spark® multimode microplate (Tecan ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Microbiology 2019Quote: ... 10µL of the sample was added in triplicate to a 96 well opaque white plate (Pierce) and analysed on the plate reader using Stop and Glo reagents (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Samples were scored using 20μL aliquots loaded into a 96-well plate and run on a GloMax Explorer Multimode Plate Reader (Promega GM3500) using the kit-provided reagents and protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Bioengineering 2023Quote: The 36PillarPlate with HLOs was sandwiched with an opaque white 384-well plate containing 20 μL of CellTiter-Glo® Reagent from CellTiter-Glo® cell viability kit (Promega, Madison, WI, USA) and 20 μL of cell culture medium in each well to measure cellular adenosine triphosphate (ATP ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...