Labshake search
Citations for Promega :
1 - 50 of 1314 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Microbiology 2024Quote: ... using random primers for cDNA synthesis and gene-specific primers (primer sequences are listed in S3 table) for qPCR (GoTaq qPCR kit, Promega). The transcript levels for innate immune factors were normalized to the geometric mean of those for the housekeeping genes ACTB and HPRT (ΔCT ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Neuroscience 2024Quote: ... Specific amplicons were prepared using several primer pairs (Table 1) in combination with GoTaq© DNA Polymerase (Promega).
-
bioRxiv - Molecular Biology 2022Quote: Edited loci were amplified using locus-specific primer pairs described in Supplementary Table 1 using GoTaq master mix (Promega) and 200ng of genomic DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (qPCR) was performed with the primers listed in Table S1 and a GoTaq qPCR Master Mix (Promega, A6002) in a Mastercycler realplex2 thermocycler (Eppendorf) ...
-
bioRxiv - Microbiology 2021Quote: ... A series of concentrations from 50-600nM in symmetric and asymmetric forward and reverse primer concentrations were added to the RT-qPCR reaction using the GoTaq 1-Step RT-qPCR System (Promega) according to the manufacturer’s instructions using the standard annealing temperature of 60°C ...
-
bioRxiv - Microbiology 2020Quote: ... were made by end-labeling one primer of a complementary pair (primers listed in Table 2) using 20 μM Cy5-dCTP and Terminal deoxynucleotidyl Transferase (TdT; Promega). Complementary primers (one labeled with Cy5 and the other unlabeled ...
-
bioRxiv - Microbiology 2020Quote: ... were made by end-labeling one primer of a complementary pair (primers listed in Table S3) using 20 μM Cy5-dCTP and Terminal deoxynucleotidyl Transferase (TdT; Promega). Complementary primers (one labeled with Cy5 and the other unlabeled ...
-
bioRxiv - Physiology 2021Quote: ... A K13 donor template consisting of a 1.5 kb region of the K13 coding region including the entire propeller domain was amplified using the primer pair p3+p4 and cloned into the pGEM T-easy vector system (Promega). This donor sequence was subjected to site-directed mutagenesis in the pGEM vector to introduce silent binding-site mutations at the Cas9 cleavage site using the primer pair p5+p6 ...
-
bioRxiv - Microbiology 2021Quote: ... A K13 donor template consisting of a 1.5 kb region of the K13 coding region including the entire propeller domain was amplified using the primer pair p3+p4 (Table S9) and cloned into the pGEM T-easy vector system (Promega). This donor sequence was subjected to site-directed mutagenesis in the pGEM vector to introduce silent binding-site mutations at the Cas9 cleavage site using the primer pair p5+p6 ...
-
bioRxiv - Genetics 2024Quote: ... The optimal annealing temperature for each primer pair was determined empirically through conventional end point gradient PCR using GoTaq Green (Promega). Gradient temperatures tested for ISR1 were ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 ng of cDNA of each sample was used for the qPCR reaction (duplicate/sample) with ENG or α-tubulin specific primers (Supp. Table 1) and the GoTaq qPCR Master mix (Promega), in presence of CXR reference dye ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Microbiology 2021Quote: qPCRs were performed with MLV SuMLV primers using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... each primer at 0.25 μM and 5 μL of 2X GoTaq qPCR Master Mix (Promega). The amplification program consisted of preincubation steps at 50°C for 2 min and 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min ...
-
bioRxiv - Genomics 2022Quote: ... The primers were commercially synthesized (IDT) and tested on human genomic DNA (Promega) to confirm generation of only one amplicon product at the expected size ...
-
bioRxiv - Cell Biology 2023Quote: ... primers designed for the gene of interest (Table 1) and GoTaq(R) qPCR Master Mix (Promega). Samples were run on an AB 7300 Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... qRT-PCR was performed with SlMYB75 specific primers (Table S3) and GoTaq qPCR Master Mix (Promega) using the CFX96 Touch Real-Time system (Bio-Rad) ...
-
bioRxiv - Physiology 2023Quote: ... primers at a final concentration of 300nM and 6µL of GoTaq® qPCR Mix (Promega, Madison, USA). qPCR conditions were the following ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Immunology 2022Quote: ... on memory CD8 T cells were quantified by qRT-PCR using a final 0.5 μM concentration of each primer and SYBR Green GoTaq qPCR Master Mix (Promega). Amplification was performed in a StepOne Plus Real time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative PCR reactions with final primer concentration of 500 nM were prepared using GoTaq qPCR master mix (Promega A6001) in 20 µl reactions and run on a Viia-7 (Invitrogen).
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real time RT-PCR (qPCR) was performed using gene-specific primers (Supplemental Table 1) and the fluorescent dye SYBR Green (Promega). All quantifications were normalized to the TIP41 (AT4G34270 ...
-
bioRxiv - Microbiology 2023Quote: ... using oligo (dT) as a primer and quantitative PCR analysis was performed using the GoTaq qPCR SYBR master mix (Promega) on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was assessed by qPCR using primers listed in the supplemental material Table S6 and the GO Taq PCR kit (Promega). Gene expression was quantified using SYBR Green (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... core and modified histones and transcription factors at the HIV-1 LTR was assessed by quantitative PCR using primers spanning the full promoter (Table 1) with GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... qRT-PCR reactions were performed using synthesized cDNAs as template and gene-specific primers (Table S1) to quantify the relative mRNA levels of Tc_WapF with GoTaq® qPCR Master Mix (Promega) according to the manufacturer’s instructions.Three independent biological replicates were used for each quantitation ...
-
bioRxiv - Genomics 2023Quote: ... Primer efficiency was calculated using a 10-fold serial dilution of Human Mixed Genomic DNA (Promega G3041). For primer sequences and calculated efficiencies ...
-
bioRxiv - Biochemistry 2021Quote: ... forward and reverse primer for the individual genes of interest (Eurofins Genomics, Germany) and GoTaq qPCR 2x Master Mix (Promega, Germany). The qPCR was carried out on a RotorGene Q (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... DNA and 5% input were analyzed by qPCR using locus specific primers (Table 3) and SYBR Green Master Mix (Promega, A6002). IP DNA values were normalized to input using the following formula ...
-
bioRxiv - Biochemistry 2022Quote: ... and M75F receptor plasmids using FuGene HD (Promega). Cells were treated with DMSO or varying drug concentrations 24 hours after transfection ...
-
bioRxiv - Developmental Biology 2022Quote: 3.3 and 3.2 kb promoter regions of alcama and pdgfra genes were cloned from BAC DNA (alcama: RP71-78P1, BACPAC Resources; pdgfra: DKEY-97C6, Source BioScience) and cloned into the pGL3 basic vector (E1751, Promega) linearized with Xho I and Hind III (pGL-alcama-luc and pGL-pdgfra-luc) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real Time PCR was done with unique oligonucleotide primers targeting ABCB11 gene using GoTaq® qPCR Master Mix (Promega Cat. No. A6001) following ‘manufacturer’s instructions on a Veriti Thermo Cycler from Applied Biosystems Waltham ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products amplified by gene-specific RT-qPCR primers listed in Supplemental Table S1 were cloned in pGEM-T Easy vector (Promega, Madison, Wisconsin, USA) prior to their sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... and qPCR using GoTaq qPCR Master Mix (Promega) on a qTower (Analytik Jena).
-
bioRxiv - Molecular Biology 2020Quote: ... and used for qPCR (GoTaq qPCR Mix, Promega) using standard protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... GoTaq® qPCR and RT-qPCR Systems (Promega), and reverse transcription system (Promega) ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR using GoTaq qPCR Master Mix (Promega) was performed on a QuantStudio7 Flex (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and used for qPCR (GoTaq qPCR Mix, Promega). Alternatively ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Genetics 2024Quote: Regulatory elements were amplified by PCR from human genomic DNA using primers listed in Supplementary Table 10 and cloned into the pGL4.23 Luciferase Reporter Vector (Promega, E8411) linearized with NheI and EcoRV (New England Biolabs ...
-
bioRxiv - Neuroscience 2021Quote: ... Random Primers (Promega), and Superscript III reverse transcriptase (Invitrogen ...