Labshake search
Citations for Promega :
151 - 200 of 5912 citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Biochemistry 2022Quote: HeLa and HEK293T cells were seeded on 18 mm glass coverslips at a density of 3×105 cells/mL and were transfected with FuGENE 6 (Promega) transfection reagent 24 h later ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... lactate assays were performed with culture media collected from each sample according to the manufacturer’s protocol and the optical density was measured at 450 nm using a microplate reader (GloMax®-Multi E7031, Promega)
-
bioRxiv - Physiology 2023Quote: ... 300 μl aliquots from each fraction after polysomal ultracentrifugation in sucrose density gradients were spiked with 100 pg of Luciferase mRNA (internal control, Promega). Then ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 4% FBS and 100 µL were seeded per well in 96-well plates at a density of 2×105 cells/mL in the presence or absence of 0.1 mM HaloTag NanoBRET™ ligand (Promega). The following morning ...
-
bioRxiv - Molecular Biology 2021Quote: ... Low passage MCF10A cells were transfected at 80% confluency in a 25cm2 flask using 25 μl FugeneHD (Promega) with 6 μg of pAS4863 and 200 ng of GBlock donor template ...
-
bioRxiv - Immunology 2022Quote: Caspase-1 activity was quantified using a Caspase-Glo 1 Inflammasome Assay kit (Promega, Madison, WI). THP-1 cells were treated and harvested as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg RNA was reverse transcribed using Reverse Transcription Kit (Promega) with oligo(dT ...
-
bioRxiv - Physiology 2024Quote: ... The optical density of the standards and samples was recorded at 450 nm wavelength using a microplate reader (Promega, GloMax 9301). All samples were run in triplicates.
-
bioRxiv - Cancer Biology 2021Quote: ... and human Renilla luciferase (pGL4.74[hRluc/TK], Promega, E6921) were used in the study ...
-
bioRxiv - Microbiology 2020Quote: ... insert (NRP1, native human ORF in pF1K, FXC23812, Promega): 5’-atagggcgaattcggtagtaaggagcgatcgc-3’ (fwd ...
-
bioRxiv - Cancer Biology 2022Quote: ... were amplified by PCR from human genomic DNA (Promega), using the primers listed in Table S1 and then inserted into the psiCHECK-2 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... human GR and MR were cloned into pACT (Promega) as N-terminal VP16 fusions using HiFi assembly (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... A cDNA encoding human KIF1A was purchased from Promega Japan (Promega Japan ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human PAR2 with N-terminal nano-luciferase (nLuc, Promega) and C-terminal enhanced Yellow Fluorescent Protein (eYFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... or goat anti-Human IgG (H+L) (Promega, W4031) antibodies were added for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... sphere cells growing in the low attachment plates were quantitated by CellTiter-Glo luminescent cell viability assay (Promega, G7571) using a SpectraMax M5 Multi-Mode Microplate Reader (Molecular Devices) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Low passage MCF10A cells were transfected at 80% confluency in a 25 cm2 flask using 25 μl FugeneHD (Promega) with 6 μg donor plasmid (pAS4885) ...
-
bioRxiv - Developmental Biology 2021Quote: Build a bigger buffer reservoir with medium or buffer containing LM agarose (Agarose, Low Melting Point, Promega Corporation V2111) in zone 2 (blue box in Fig ...
-
bioRxiv - Cancer Biology 2023Quote: The 3-dimensional (3D) culture studies were performed using MCF-7 cells and low melting point agarose (Promega, Australia). Agarose was suspended in PBS at a concentration of 0.75% (w/v) ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue supernatant were used to estimate BDNF (detection limits 7.8-500 pg/ml) by ELISA (BDNF Emax Immuno Assay System, #G7611, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 250 µL of BMB was added to each well and the optical density of the samples was read using a Glomax plate reader set at 525 nm (Promega, Madison, USA). The amount of GAG in each sample is expressed as a percentage of the dry weight of the digested ECM.
-
bioRxiv - Genomics 2021Quote: ... were transfected at 20 μM in SK-N-SH cells at a density of 104 -105 cells using FuGene HD Transfection reagent (Promega Corporation, USA) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... were transfected at 25 µM concentration in SK-N-SH cells at a density of 104 -105 cells using FuGene HD Transfection reagent (Promega Corporation, USA), per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Neuroscience 2019Quote: ... a second pool was fixed to the first pool using a drop of agarose low melting 3% (Promega, Ref. V2111) in Leibovitz’s L15 medium (Gibco Life Technologies ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 μg plasmid DNA was co-transfected with same amount of low-rate constitutively expressed pRL-TK Renilla luciferase vector (Promega) into mesophyll protoplasts isolated from A ...
-
bioRxiv - Immunology 2024Quote: ... 48 hours later the media was removed and replaced with 25 µL of RMPI-1640 media supplemented with 2% low-IgG FBS (Promega). Antibodies were serially diluted 1:10 in RPMI 1640 media from a starting concentration of 30 µg/mL to a final concentration of 0.014 µg/mL and 25 µL of antibody dilution was added to the plate ...
-
bioRxiv - Molecular Biology 2021Quote: The CD19 minigene was amplified from human genomic DNA (Promega) with the primers 5’-catAAGCTTgaccaccgccttcctctctg-3’ and 5’-catGAATTCNNNNNNNNNNNNNNNGGATCCttcccggcatctccccagtc-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the human CB1R was cloned into the pCI vector (Promega), and eCB2.0 and eCBmut were cloned into the peGFP-C1 vector (Takara) ...
-
bioRxiv - Immunology 2022Quote: ... and a β-globin calibration curve (human genomic DNA [Promega]) was concurrently evaluated on each plate ...
-
bioRxiv - Microbiology 2020Quote: ... The human codon-optimized NanoLuc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... donovani BPK282/0 cl4 promastigote DNA with human DNA (Promega) from 1/15 to 1/150000 (Leishmania:human ...
-
bioRxiv - Biochemistry 2020Quote: hnRNP L and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Immunology 2020Quote: ... The human codon-optimized nanoluc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Serial dilutions of genomic DNA from human placenta (G1471, Promega) were used as a standard for quantification and their concentration.
-
bioRxiv - Microbiology 2022Quote: ... falciparum 3D7 DNA with commercially available human DNA (Promega, G304A) to a total amount of 400ng DNA ...
-
bioRxiv - Neuroscience 2024Quote: Human male genomic DNA obtained from Promega (Ref:G1471; Madison, WI) was used to generate the input library ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... 24h prior to imaging cells were co-transfected with human PEX31-42-GFP-Halo and either human HAP1-mCherry-eDHFR or mouse BICD21-572-mCherry-eDHFR using FuGENE 6 (Promega; 1 µg total DNA) and 48h prior to imaging with control siRNA using Lipofectamine RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... infected target cells were washed with DPBS and the medium was replaced with 50 μl of RPMI 1640 with 4% low IgG serum (Promega # G711A) containing 5 x 104 Jurkat effector cells (Promega # G701A ...
-
bioRxiv - Microbiology 2021Quote: ... as described above was digested with chymotrypsin or trypsin/lysC using the Accumap™ low pH sample preparation with urea under nonreducing conditions (Promega). The free cysteines in the Mpro preparations (100 µg ...
-
bioRxiv - Microbiology 2023Quote: ... infected target cells were washed with DPBS and the medium was replaced with 40 μl of RPMI 1640 with 4% low IgG serum (Promega # G711A) containing 5 x 104 Jurkat effector cells (Promega # G701A ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein spots were digested with either 12.5 ng/µL trypsin for low-intensity or 6.25 ng/µL trypsin for high-intensity spots (Promega, Fitchburg, FI, USA) for 18 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...