Labshake search
Citations for Promega :
1 - 50 of 4629 citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Riboprobes for in situ hybridisation were generated by cloning transcript-specific PCR products into pGEM-T-Easy (Promega, A1360) using the TA-cloning method ...
-
bioRxiv - Microbiology 2021Quote: ... Tubulin β (ML841/ML842) or actin (ML843/ML844) were used to amplify specific transcripts with the GoTaq DNA polymerase (Promega). PCR was performed with 21 cycles of denaturation (30 s ...
-
bioRxiv - Cell Biology 2021Quote: The Rosa26 promoter and the 5’UTRs of secretory granule protein transcripts were subcloned into the pNL1.1 (Promega) using standard cloning techniques ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA (1.2 µg) was utilized to reverse transcript with M-MLV Reverse Transcriptase kit (M1701, Promega), Random Hexamer Primers (48190011 ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Immunology 2021Quote: ... All transcripts were translated in rabbit reticulocyte lysate (Promega) in the presence of L-35S-methionine (Perkin Elmer) ...
-
bioRxiv - Cell Biology 2023Quote: ... transcripts were incubated with rabbit reticulocyte lysates (L4960; Promega) for 30 min at 37°C.
-
bioRxiv - Developmental Biology 2023Quote: ... RT-PCR for mRNA transcripts was performed by using the ImProm-II Reverse Transcription System kit (Promega A3800). Real Time PCR was performed with Applied Biosystems Fast SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 4 μg of the extracted material was then used as template to in vitro synthesized viral genomic RNA transcripts using the Ribomax T7 RNA transcription Kit (Promega) and Ribo m7G Cap Analogue (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 4 μg of the extracted material was then used as template to in vitro synthesized viral genomic RNA transcripts using the Ribomax T7 RNA transcription Kit (Promega) and Ribo m7G Cap Analogue (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 4 µg of the extracted material was then used as template to in vitro synthesized viral genomic RNA transcripts using the Ribomax T7 RNA transcription Kit (Promega) and Ribo m7G Cap Analogue (Promega ...
-
bioRxiv - Microbiology 2022Quote: In vitro generated RNA transcripts above were used templates for in vitro translation assays using a Rabbit Reticulocyte Lysate kit (Promega) at the indicated concentrations ...
-
bioRxiv - Cell Biology 2022Quote: ... mRNA transcripts were then translated in rabbit reticulocyte lysate (RRL) (Promega) in the presence of L-35S-methionine (PerkinElmer ...
-
bioRxiv - Systems Biology 2020Quote: ... albicans as well as of a commercially available human protein digest (Promega), which was exclusively used in this experiment ...
-
bioRxiv - Biochemistry 2023Quote: MS-Compatible Human Protein Extract Digest (K562) was purchased from Promega (V6951), MassPREP E ...
-
bioRxiv - Molecular Biology 2020Quote: Strand-specific RNA probes were generated using a T3 in vitro transcription kit (Promega) in the presence of Chromatide AlexaFluor-UTP (ThermoFisher) ...
-
bioRxiv - Plant Biology 2023Quote: ... Quality was assessed by Agilent Bioanalyser and the amount was calculated by an RNA-specific kit for Quantus (Promega). An Illumina-compatible library was prepared with the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina ® and finally sequenced on a HiSeq 3000 at the Max Planck-Genome-centre Cologne.
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Genomics 2019Quote: ... PCR was performed with gene-specific primer pairs (Table S15) using a DNA polymerase kit (Promega). The PCR conditions were 95 °C for 3 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantification of transcripts was performed using the GoTaq® qPCR Master Mix (#A6002, Promega) on a LightCycler 96 instrument (Roche) ...
-
bioRxiv - Physiology 2023Quote: ... with adipose transcripts amplified with GoTaq® qPCR master mix (Promega, Cat. No A6001) using a ViiA 7 PCR system (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... and Pierce 660nm Protein Assay kit (Promega) was used for quantification ...
-
bioRxiv - Genomics 2020Quote: ... Different transcripts were then compared by qPCR using GoTaq® qPCR Master Mix (Promega, A6001) and primers specific for selected genes and GAPDH (see Table S3B) ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell lysates were pre-cleared of any non-specific streptavidin-binding proteins by incubating with 60 µL of MagneSphere paramagnetic particles (Promega, Madison, WI) for 30 min with rotation ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... AccuMAP™ Low pH Protein Digestion Kit (Promega) according to the manufactures protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... A direct cAMP ELISA kit (Enzo) was used in endpoint experiments and the pGloSensor (−20F) luminescence assay (Promega) was used for kinetic cAMP measurements ...
-
bioRxiv - Genomics 2020Quote: The mid-transcript PCR product was ligated to pGEM®-T Easy vector (Promega Corporation, USA), following the manufacturer’s instructions and transformed into E ...
-
bioRxiv - Bioengineering 2022Quote: A 1000 nucleotide transcript was transcribed using the Ribo-probe Combination System--SP6/T7 RN (Promega), according to the manufactures instructions ...
-
bioRxiv - Microbiology 2022Quote: ... [32P]-dCTP labelled hmbA and 18S rRNA gene-specific DNA molecules were used as gene probes using the random hexanucleotide-primer kit following the supplier’s instructions (Promega). As a loading control ...
-
bioRxiv - Microbiology 2023Quote: The potential for M2e-specific antibodies to induce ADCC was evaluated using a mouse FcγRIV ADCC Reporter kit (Promega). In brief ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... in vitro RNA transcripts were generated using the T7 Ribomax Express Large Scale RNA Production System (Promega). Transcripts were purified (RNA Clean and Concentrator ...
-
bioRxiv - Molecular Biology 2023Quote: ... Diluted RNA was assayed for AGO2 transcript using the GoTaq 1-Step RT-qPCR System (Promega A6020) with primers CTGGCTCCAGGGGACAAG (Forward primer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Quality was assessed with an Agilent Bioanalyser and the quantity was calculated by an RNA-specific kit from Quantus (Promega).
-
bioRxiv - Developmental Biology 2024Quote: ... For RT-qPCR four micrograms of the extracted RNA from each sample were reverse transcribed with gene specific primers using Goscript reverse transcription kit (Promega). Quantitative PCR was performed using Power SYBR Green (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein concentration was estimated using a BCA kit (Promega). The blots were blocked using 5% NFDM (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was determined using Bradford Assay Kit (Promega, USA) and equal amounts of proteins were denatured ...
-
bioRxiv - Molecular Biology 2021Quote: RNAs transcripts were generated by in vitro transcription using the RiboMAX™ Large Scale RNA Production Systems (Promega). Reactions were set up by adding 2 µL of the T7 Transcription 5X Buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: RNAs transcripts were generated by in vitro transcription using the RiboMAX™ Large Scale RNA Production Systems (Promega). Annealed oligonucleotides forward and reverse containing the T7 promoter and the sRNA were used as template ...
-
bioRxiv - Immunology 2020Quote: ... were transfected with 4.5 µg of the pBabe-puro-NCAM140 mApple construct (NCBI reference sequence: NM_000615.6, transcript variant 1) using Fugene 6 Transfection Reagent (Promega). Supernatant containing viral particles was collected and concentrated using PEG-IT (System Biosciences ...
-
bioRxiv - Pathology 2021Quote: ... One µL of PCR product was employed to produce the transcripts with the T7 RNA polymerase (Promega, USA), setting a 20 µL-reaction for 2 hours at 37 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcripts of interest were amplified using designed primers (Supplementary Table 4) and cloned into pGEMT-Easy vector (Promega). Digoxigenin-labelled antisense and sense RNA probes were transcribed from T7 or SP6 promoter of pGEMT-Easy vector (Promega ...
-
bioRxiv - Immunology 2023Quote: ... Cells were collected after 24 hours and luciferase assays were performed using a dual-specific luciferase assay kit (Promega, WI, US) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... after which D-luciferin-specific Quantilum Recombinant Luciferase (Promega) was added to a final concentration of 25 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Baseline fluorescence was measured in an ELISA reader (Promega) following an incubation of 30 min at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Cancer Biology 2020Quote: ... Presence or absence of transcript was detected by a regular PCR using GoTaq® G2 DNA Polymerase (Promega, M7841) from 100ng cDNA and visualized on an agarose gel.
-
bioRxiv - Cell Biology 2022Quote: The S1PR1 3’UTR sequences and mutant sequences (200 bp upstream and 200 bp downstream of the binding site from NM_007901.5 transcript) were synthesized and cloned into wildtype plasmid pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, USA) by Generay (China) ...