Labshake search
Citations for Promega :
551 - 600 of 966 citations for Human IgG1 Anti Zika Virus NS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2020Quote: ... the blot was blocked with either 5% nonfat-milk or 5% BSA in TBST before addition of primary antibodies and followed with peroxidase-conjugated secondary antibody (Promega). Protein bands were detected using SuperSignal Chemiluminescent Substrate (Pierce ...
-
bioRxiv - Microbiology 2019Quote: The following commercial antibodies and dilutions were used for immunoblotting: rabbit polyclonal antibody to HaloTag (Promega; G9281; 1:1,000 dilution), mouse monoclonal antibody to lamin A/C (Cell Signalling ...
-
bioRxiv - Immunology 2020Quote: ... were used as primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies were from Promega (Rabbit W401B and Mouse W402B), and the substrate ECL was detected by Pierce ECL2 solution (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Appropriate HRP conjugate secondary antibodies were from Promega. Signal was detected using the ECL system (BioRAD ...
-
bioRxiv - Immunology 2019Quote: ... Secondary antibody (α-Goat HRP, Promega, 1:10,000). The blot was developed using ECL Western Blotting Substrate (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... Halo-tag (G9211) antibody was purchased from Promega. The C11orf53 antibody was produced in rabbit in house by using full-length C11orf53 recombinant protein as antigen.
-
bioRxiv - Immunology 2019Quote: ... NLuc (Lg-BiT) polyclonal antibody (courtesy of Promega), human Caspase-1 p20 Rabbit polyclonal Ab (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2019Quote: ... 2° antibodies α- mouse (HRP detection, Promega, W4021). The mean intensity quantification of 4 independent experiments is shown in Figure 4 – supplement 1B ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary HRP-conjugated antibodies were purchased from Promega or GE Healthcare (anti-mouse Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... an antibody against HaloTag (G9211) was from Promega; an antibody against GFP (7.1/13.1 ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP conjugated anti-rabbit (W4011) and anti-mouse (W4021) were from Promega and used at a dilution of 1:10000 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-rabbit (Promega, W401B) antibodies at a concentration of 1:10 000 and anti-rat IgG1 (Monoclonal Antibody Core Facility ...
-
bioRxiv - Microbiology 2021Quote: ... anti-Halo-tag (Promega), anti-FLAG (M2 ...
-
bioRxiv - Physiology 2022Quote: ... Anti-rabbit (Promega, #W401B), anti-guinea pig (JacksonImmuno ...
-
bioRxiv - Cancer Biology 2019Quote: ... rabbit anti-pJNK (Promega) at 1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-Halo (G9211; Promega), anti-Tubulin (100109-MM05T ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-rabbit (Promega, #W401B) and anti-chicken (Promega ...
-
bioRxiv - Immunology 2021Quote: ... or anti-goat (Promega) secondary antibodies conjugated to horseradish peroxidase ...
-
bioRxiv - Genetics 2022Quote: ... anti-rabbit-IgG (Promega), or anti-rat-IgG (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-rabbit HRP (Promega) or anti-mouse HRP (Promega ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... anti-β-galactosidase (Promega, Z3783 ...
-
bioRxiv - Plant Biology 2023Quote: ... or anti-mouse (Promega) in 5% low-fat milk in TBS-T for 1 hour ...
-
bioRxiv - Physiology 2024Quote: ... anti-rabbit HRP (Promega) or anti-mouse HRP (Promega ...
-
bioRxiv - Microbiology 2019Quote: The following commercial antibodies and dilutions were used for immunofluorescence staining: rabbit polyclonal antibody to HaloTag (Promega; G9281; 1:500 dilution), mouse monoclonal antibody to lamin A/C (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... and SERBP1 were amplified from human cDNA and cloned into the appropriate vectors (pACT or pBIND) provided by the CheckMate Mammalian Two-Hybrid kit (Promega E2440). The appropriate combination of edited pACT and pBIND vectors ...
-
bioRxiv - Genomics 2020Quote: ... standard curves were generated by preparing 10 fold dilution series of plasmid DNA containing parasite 18SrRNA gene54 and from human genomic DNA (Cat No. G304, Promega, Australia). Thermal cycling was performed on a Light Cycler 480 II (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... or human IFN-β (1000 U/ml) and firefly luciferase activity was determined using the dual luciferase reporter assay system (Promega) on Cytation 3 (BioTek ...
-
bioRxiv - Immunology 2022Quote: The constant regions of the human TCR genes were replaced with murine constant genes by overlapping PCRs as previously described,14 and the human/murine hybrid TCR genes were sub-cloned into the pGEM-4Z vector (Promega Corporation) for mRNA expression ...
-
bioRxiv - Immunology 2022Quote: ... pneumoniae D39 or the isogenic mutants towards human epithelial cells was accessed using a CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... The immunoblots were probed with appropriate secondary antibodies (Promega) and visualised by chemiluminescence (Supersignal detection kit ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... Secondary antibody (donkey α-goat HRP, Promega, 1:10,000). For His-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by blotting with HRP-conjugated secondary antibodies (Promega). The protein bands were obtained with the ChemiDoc XRS+system (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction of samples was performed according to an adapted version of the “DNA purification from human feces using the Maxwell® RSC instrument and the Maxwell® RSC PureFood GMO and Authentication Kit” developed by Promega (Promega Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... RPGR wild-type minigene construct was generated (Figure 2A) by amplification from a pool of human female genomic DNAs (Promega, Milan, Italy) using the following primers:
-
bioRxiv - Biophysics 2022Quote: pHalo-PPARγ2 expresses human PPARγ isoform 2 fused to HaloTag in the N-terminus under a CMVd1 promoter (Promega ORF clone #FHC08305). PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: The extent of ADCC activation induced by human γ-globulins was evaluated with the use of an ADCC Reporter Bioassay (Core Kit; Promega, G7010) and the EnSpireMultimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Cell Biology 2023Quote: ... the corresponding promoter regions of the human KLF2 and KLF4 genes were amplified using human genomic DNA as a template and cloned into the BglII site of the GL4 basic vector (Promega, Fitchburg, WI). Point mutants of the vectors were constructed by site-directed mutagenesis using a QuikChange Site-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Immunology 2024Quote: ... qPCR targeting the β-globin gene was performed for each sample and evaluated alongside a β-globin calibration curve (human gDNA, cat# G1521, Promega).
-
bioRxiv - Molecular Biology 2019Quote: ... Horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit IgG (Promega; 1:10,000) was incubated for 1 h at room temperature and then washed four times with PBS-Tween for 20 min ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: Anti-mouse and anti-rabbit Abs conjugated with horseradish peroxidase (HRP) were from Promega Biotec (Madison ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-goat-HRP (Promega V8051) 1:10,000 ECL-Plus (GE) ...
-
bioRxiv - Biophysics 2020Quote: ... or Anti-HaloTag (Promega G9281) according to the manufacturer’s instructions ...