Labshake search
Citations for Promega :
401 - 450 of 3123 citations for Human IgG1 Anti Dengue Virus NS1 Serotype 1 Antibody OB4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Cell Biology 2021Quote: ... A polyclonal goat anti-mouse conjugated to horseradish peroxidase (1:5000, 1:10000 or 1:20000; Promega) was used as secondary antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... The peroxidase-conjugated secondary antibodies were goat anti-mouse IgG (715-035-151, Promega) and anti-rabbit IgG (711-035-152 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Control immunoprecipitations (mock) were performed with a non-specific antibody (Anti-Rabbit IgG, Promega). Western blot analyses were performed using the following antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... and goat anti-rabbit IgG (H+L) antibody conjugated to HRP (Promega, catalog # W4018). Immunoblots were imaged using iBright 1500 (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... The secondary antibody is anti-guinea pig IgG conjugated to horseradish peroxidase (HRP) (Promega). ImageQuant LAS4000 camera (GE Healthcare Life Sciences ...
-
bioRxiv - Bioengineering 2022Quote: ... Horseradish peroxidase-conjugated anti-rabbit IgG (H + L) secondary antibody (W401B; Promega, Madison, WI) was used at a dilution rate of 1:5,000 for anti-TNF-α or -IL- 1β blotting ...
-
bioRxiv - Plant Biology 2021Quote: ... Expression of MYB24 was confirmed by western blot using an anti-HaloTag antibody (Promega). The protein expression reaction was mixed with HaloTag-ligand conjugated magnetic beads (Promega ...
-
bioRxiv - Immunology 2021Quote: ... adding rabbit anti-chicken IgY which HRP-conjugated secondary antibodies (Promega, Madison, WI, USA) in the dilution of 1:5000 and incubated at 37°C for an hour ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by the secondary anti-rabbit HRP-conjugated antibody (W401B, Promega, Madison, Wi, USA), diluted 1:10.000 in 5% BSA TBS-T ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were washed with TBS-T and incubated for 60 min at room temperature with an anti-mouse or anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody (Promega, Germany) at dilutions of 1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-b-111-tubulin (mouse, Promega G712A, 1:500), Cleaved caspase-3 (rabbit ...
-
bioRxiv - Molecular Biology 2019Quote: Goat anti-mouse IgG HRP 1:2000 (Promega W4021)
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-NLuc (kind gift of Promega, 1:1000) and b-actin-peroxidase (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-NLuc (kind gift of Promega, 1:100). The following Alexa Fluor secondary antibodies were used ...
-
Neuronal L-Type Calcium Channel Signaling to the Nucleus Requires a Novel CaMKIIα-Shank3 InteractionbioRxiv - Neuroscience 2019Quote: ... HRP-conjugated anti-mouse (Promega, catalog W4021, 1:6000), HRP-conjugated anti-goat (Abcam ...
-
Neuronal L-Type Calcium Channel Signaling to the Nucleus Requires a Novel CaMKIIα-Shank3 InteractionbioRxiv - Neuroscience 2019Quote: ... HRP-conjugated anti-rabbit (Promega, catalog W4011, 1:6000), HRP-conjugated anti-mouse (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... and Donkey anti-rabbit HRP (Promega W401B, 1:10,000). Soluble protein samples were normalized to REVERT total protein stain (Li-Cor).
-
bioRxiv - Neuroscience 2019Quote: ... The HRP-conjugated goat anti-mouse (1:10,000; Promega) and goat anti-rabbit IgG (1:10,000 ...
-
bioRxiv - Genomics 2022Quote: ... or anti-Mouse IgG HRP Conjugate (Promega, 1:2,000) diluted in blocking buffer followed by washing in TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-rabbit IgG HRP (Promega, WB 1:10,000)
-
bioRxiv - Cell Biology 2022Quote: ... and anti-rabbit IgG HRP (Promega, WB 1:10000).
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-beta Galactosidase (Promega, Cat #Z378A. 1:1000). DAPI (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... pAb rabbit anti-active JNK (V7931, 1:100, Promega) and pAb rat anti-Crb antibody (F3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-β-Gal (1:1000, Promega, Cat#: Z3781), rabbit anti-β-galactosidase (1:5000 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rabbit (1/20000, Promega, W4021 and W4011, respectively) and anti-rat (1/10000 ...
-
bioRxiv - Molecular Biology 2019Quote: Goat anti-rabbit IgG HRP 1:1000 (Promega W4011)
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-β-galactosidase (1:1,000, Promega, Cat#: Z3781), rabbit anti-β-galactosidase (1:5,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse Anti-β-Galactosidase (#Z3781, 1:200) from Promega; rabbit anti-SWS (1:1000 from Doris Kretzschmar) ...
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mouse anti-β-galactosidase (Promega #Z378, 1:1000) or rabbit anti-mCherry (BioVision ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: The following commercial antibodies and dilutions were used for immunoblotting: rabbit polyclonal antibody to HaloTag (Promega; G9281; 1:1,000 dilution), mouse monoclonal antibody to lamin A/C (Cell Signalling ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Physiology 2020Quote: ... oligo-dT primed cDNA was synthesized from 500 ng of total RNA using Murine Moloney Leukaemia Virus reverse transcriptase (Promega, USA). qRT-PCR was performed using a ViiA Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... the cell viability of each infected virus variants was measured using CellTiter 96 Aqueous One solution Cell Proliferation Assay (Promega, USA). The relative cell viability was calculated by normalizing the absorbance value of treated virus samples against untreated virus samples ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Microbiology 2022Quote: ... We performed duplicate serial dilutions using supernatants collected from the virus rescues and measured luciferase expression at each dilution using Bright-Glo Luciferase Assay System (Promega, E2610). Virus titers were calculated as relative light units (RLU ...
-
bioRxiv - Molecular Biology 2023Quote: ... Produced pseudoviruses were titrated on HEK-293T-ACE2 by performing duplicate serial dilutions and virus titers were measured 48 hours after infection using Bright-Glo Luciferase Assay System (Promega, E2610).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were incubated at 37 °C for two days and the nLuc activity from the virus replication was measured by using Nano-Glo® Luciferase Assay System (Promega) following the manufacturer’s protocol using a plate reader (HT4 Biotek) ...
-
bioRxiv - Immunology 2024Quote: ... The virus neutralization titers were determined by measuring the NLuc activity using the Nano-Glo Luciferase Assay System (Promega, Madison, WI) following the manufacturer’s conditions ...