Labshake search
Citations for Promega :
201 - 250 of 5826 citations for Human Calcipressin 1 RCAN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Cell viability was assayed starting at Day 1 for 6 days according to the CellTiter-Glo 3D kit (Promega G9683). For the antiandrogen response assay ...
-
bioRxiv - Microbiology 2023Quote: ... core and modified histones and transcription factors at the HIV-1 LTR was assessed by quantitative PCR using primers spanning the full promoter (Table 1) with GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We isolated and purified genomic DNA from 1 mL of the overnight cultures using the Wizard DNA purification kit (Promega). Short-read sequencing (2 x 150bp paired-end reads ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with a control Flag or HA-GSK-3βWT human plasmid using Fugene 6 (Promega #E2693) in a 2:1 ratio and incubated for 3 hours in a CO2 incubator ...
-
bioRxiv - Cancer Biology 2020Quote: ... T47D cells and MCF7 cells were transfected with empty or human LIP-containing pcDNA3.1 via Fugene HD (Promega) using the manufactures protocol ...
-
bioRxiv - Cancer Biology 2021Quote: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene (LGALS1 pGL4.23 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MV4-11 (DSMZ Cat# ACC-102, RRID:CVCL_0064) human AML cell lines were identified by PCR-single-locus-technology (Promega, PowerPlex21 PCR Kit ...
-
bioRxiv - Biophysics 2019Quote: The cell-viability of human neuroblastoma (SH-SY5Y) cells was measured using MTT cell proliferation assay (Promega, G4000). SH-SY5Y cells were plated in a 96-well plate followed by differentiation in Neurobasal-A ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Biophysics 2021Quote: ... Human Gβ with a C-terminal 15-amino-acid polypeptide linker followed by a HiBiT (peptide 86, Promega) and human Gγ were cloned into pFastBac vector ...
-
bioRxiv - Neuroscience 2024Quote: ... human CaV1.3 cDNA (accession number NM_001128840.2) was de-novo synthesized and assembled into a HaloTag vector (Promega G7721) using restriction cloning ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Genetics 2021Quote: ... Approximately 1 μg RNA per sample was converted to cDNA using the ImProm-II Reverse Transcription System kit (Promega, Madison, WI) using the Oligo(dT)15 primer supplied with the kit and with a final concentration of 3 mM MgCl2 according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Around 1×105 cells were treated as indicated prior to lysis and RNA isolation using the ReliaPrep™ RNA Miniprep kit (Promega). Approximately 1μg of total RNA was reverse transcribed into cDNA using SuperScript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 1/6th of the diaphragm) using a Maxwell RSC Instrument and Maxwell RSC simplyRNA Tissue Kit (both Promega, Southampton, UK) and complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Biophysics 2023Quote: ... from the access handles by running this on a 1% agarose gel and gel purify the right DNA fragment with a gel purification kit (Promega, A9282).
-
bioRxiv - Genomics 2023Quote: ... cells were washed once with cold 1× PBS and the luciferase activities were measured with Perkin Elmer Envision using Promega Dual Luciferase Assay kit (Promega, E1960). The firefly luciferase activity was normalized to renilla luciferase activity for each well ...
-
bioRxiv - Microbiology 2023Quote: ... We used 1 ml of cultures and isolated the genomic DNA using the Wizard Genomic DNA Purification Kit (Promega; Madison, WI). We used the DNA with the Illumina DNA Prep kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Positive clones were cultured in liquid LB medium supplemented with kanamycin (50 μg mL−1) for extraction of plasmid DNA with the Wizard Plus SV Minipreps DNA Purification System Kit (Promega - Madison, USA). Plasmids with unique EcoRI/HindIII restriction patterns were subjected to re-transformation and phenotypic confirmation by streaking the clones in solid LB medium supplemented with kanamycin (50 μg mL−1) ...
-
bioRxiv - Microbiology 2021Quote: ... Primary human airway epithelial cells were homogenized in homogenization solution supplemented with 1-thioglycerol and lysed by addition of lysis buffer (Maxwell 16 LEV simplyRNA cells kit; Promega #AS 1270). Prior to RNA extraction ...
-
bioRxiv - Cancer Biology 2019Quote: ... rat or cynomolgus ICOS as target cells were co-incubated with ADCC reporter cells expressing human FcγRIIIa (V158; Promega) at a 5:1 ratio ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter area of human Rpl28 gene was cloned at HindIII/NcoI site of the pGL3-basic (Promega, E1751) to make pGL3-reporters ...
-
bioRxiv - Genomics 2022Quote: Approximately 500-bp regions of DNA containing rs80282103 and rs11154336 were amplified from purified human genomic DNA (Promega, #G1521) by PCR using engineered restriction sites to allow directional cloning into the multiple cloning region of the pGL4.23[luc2/minP] luciferase reporter vector (Promega ...
-
bioRxiv - Neuroscience 2021Quote: We constructed luciferase reporter plasmids by cloning an ∼900 bp region containing human 1b30 into the pGL4.24 vector (Promega) upstream of the minP ...
-
bioRxiv - Biophysics 2022Quote: ... pHalo-SMARCA4 expresses human SMARCA4 with HaloTag fused to the N-terminus under a CMVd1 promoter (Promega ORF FHC12075). pHalo-MED26 expresses human MED26 fused with a HaloTag at the N-terminus and was a kind gift from Joan Conaway’s lab ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Microbiology 2023Quote: ... and Sp-EVs towards human endothelial cells was accessed by the CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Cell Biology 2020Quote: ... caspase8 Kit (Promega company); Caspase3 / 7 Kit (Promega company).
-
bioRxiv - Molecular Biology 2020Quote: ... or Maxwell kit (Promega). Following RNA extraction ...
-
bioRxiv - Genetics 2023Quote: ... the GoScript Kit (Promega) was used to make cDNA and qRT-PCR performed on a BioRAD c1000 Touch thermocycler.
-
bioRxiv - Molecular Biology 2019Quote: ... a total of 1□μg of RNA for each sample was reverse-transcribed to cDNA using reverse-transcription kits (Promega, Madison, WI, USA), and real-time quantitative reverse transcription (qRT)-PCR was performed on a 7500 real-time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 μL of N2 primers and probe (2019-nCov CDC EUA Kit, Integrated DNA Technologies) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Genomics 2023Quote: ... The resulting DNA was resuspended in 1× IDTE buffer (Integrated DNA Technologies, Coralville, IA, USA) and quantified using the QuantiFluor One dsDNA kit (Promega, Madison, WI, USA). The HiFi reads were obtained using the SMRT Cell 8M and the PacBio Sequel II instrument ...
-
bioRxiv - Microbiology 2024Quote: ... Six presumptive transconjugant colonies were randomly selected and grown overnight in 1 mL of LB prior to DNA extraction using the Wizard® Genomic DNA Purification kit (Promega, Madison, WI). The AMR genotypes of transconjugant colonies were determined by polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...