Labshake search
Citations for Promega :
201 - 250 of 3479 citations for Human Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Microbiology 2020Quote: NCIMB8209 DNA was isolated using a commercial kit (Wizard Genomic DNA purification kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... column purification kits or Maxwell 16 LEV simplyRNA Purification Kits (Promega, Madison, WI, USA) and prepared cDNA libraries using TruSeq RNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2022Quote: DNA was extracted with several different kits: the Wizard Genomic DNA Purification kit (Promega), the Qiagen Blood & Tissue kit ...
-
bioRxiv - Genomics 2020Quote: ... standard curves were generated by preparing 10 fold dilution series of plasmid DNA containing parasite 18SrRNA gene54 and from human genomic DNA (Cat No. G304, Promega, Australia). Thermal cycling was performed on a Light Cycler 480 II (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... or human IFN-β (1000 U/ml) and firefly luciferase activity was determined using the dual luciferase reporter assay system (Promega) on Cytation 3 (BioTek ...
-
bioRxiv - Immunology 2022Quote: The constant regions of the human TCR genes were replaced with murine constant genes by overlapping PCRs as previously described,14 and the human/murine hybrid TCR genes were sub-cloned into the pGEM-4Z vector (Promega Corporation) for mRNA expression ...
-
bioRxiv - Immunology 2022Quote: ... pneumoniae D39 or the isogenic mutants towards human epithelial cells was accessed using a CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Microbiology 2019Quote: The luciferase assay kit (Promega) was used to test the expression and regulation performance of the selected transactivator-positive clones ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase3 / 7 Kit (Promega company).
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... Access RT-PCR kit (Promega) was used for characterization of recombinant influenza viruses.
-
bioRxiv - Microbiology 2019Quote: ... Wizard gDNA Purification Kit (Promega) was used to isolate and purify gDNA from CEM-SS cells.
-
bioRxiv - Cancer Biology 2019Quote: ... The dual luciferase kit (Promega) was used to measure activity using a luminometer ...
-
bioRxiv - Plant Biology 2020Quote: ... A Dual Luciferase kit (Promega) was used to detect reporter activity ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primers Kit (Promega, A2800) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gaussia luciferase kit from Promega was used for detecting secreted Gaussia luciferase signal as per manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... the commercial AMPGlo kit (Promega) was used according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2021Quote: ... chromosomal isolation kit (Promega (USA)) ...
-
bioRxiv - Plant Biology 2020Quote: ... Oligo dT kit (Promega, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... GoTaq®qPCR kit (Promega) was used for qPCR analysis ...
-
bioRxiv - Genomics 2021Quote: ... PureYield plasmid miniprep kits (Promega), or QIAprep Spin Miniprep kits ...
-
bioRxiv - Cell Biology 2022Quote: ... The MTT assay kit (Promega) was used according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: GoTaq DNA polymerase kits (Promega) were used for PCR reactions ...
-
bioRxiv - Genomics 2023Quote: ... the Tunnel staining kit (Promega) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... sequencing reaction (fmol kit, Promega) using the same end labeled primer was run to identify the exact position of RT stops.
-
bioRxiv - Neuroscience 2023Quote: ... Oligo (dT) kit (Promega, #A2791) to reverse transcribe the RNA into cDNA following the manufacturer protocol.
-
bioRxiv - Microbiology 2023Quote: ... Reverse Transcription Kit (Promega, USA); IBV nucleic acid amplification fluorescence detection kit (Shanghai Furex Medical Scientific and Technological Development Co. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Core Kit (Promega, Wisconsin, USA), following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using a commercial kit (Wizard Genomic DNA Purification Kit, Promega, Madison, WI). Libraries were produced by first fragmenting 75 ng DNA with the Nextera reagent (Illumina ...
-
bioRxiv - Zoology 2024Quote: DNA was extracted with several different kits including the Wizard Genomic DNA Purification kit (Promega) and the Qiagen Blood & Tissue kit ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-untranslated region (3’-UTR) fragment of IκBα (human/rat) was inserted into the pGL3-basic vector (firefly luciferase; Promega, Madison, WI, USA), which was obtained from General Biosystems (Anhui ...