Labshake search
Citations for Promega :
1 - 50 of 2659 citations for Heme oxygenase 1 HO 1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 1 ug human DNA (Promega, Madison, WI), 5 ug sheared salmon sperm DNA (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... The quantity of monomeric heme was then measured at 405 nM on a Glomax® Explorer Fully Loaded (Promega). Three or four biological replicates were performed ...
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... we used a 1/1500 artificial mix of promastigote DNA and human DNA (Promega) to reflect the median ratio found in clinical samples ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were co-transfected in a 1:1 ratio with either human D1 or D2Long receptor and a split-luciferase based cAMP biosensor (GloSensor, Promega, Durham NC). The next day ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: ... 1 U μl−1 RNasein (Promega), 0.1% IGEPAL CA-630 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Cell Biology 2019Quote: ... diluted 1/500 in PBS-BSA 1% and 0.4 U.mL-1 RNAsin (Promega). We visualized and quantified 5-FUrd incorporation by using high content imaging device (OPERETTA ...
-
bioRxiv - Immunology 2021Quote: ... A 1:1 dilution of Steady Glo (Promega) and Lysis Buffer were added to the cells and incubated at RT for 15 mins ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-1-gal (1:1000, Promega Z378B), mouse anti-1-gal (1:1000 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... 1 mM CaCl2 with 1 µg trypsin (Promega). Digested proteins were acidified with TFA to pH < 2 and RapiGest SF was precipitated out ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-β-Galactosidase (1:1.000; Promega, 1:1000; abcam), anti-Cleaved Caspase-3 (1:500 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 µl random primers (50 ng·µl−1, Promega, C1181), 2 µL 0.1M DTT ...
-
bioRxiv - Biochemistry 2024Quote: ... 7C (mouse, Promega cat# N700A; 1:500-1:1000); Nluc in Fig ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... 24h prior to imaging cells were co-transfected with human PEX31-42-GFP-Halo and either human HAP1-mCherry-eDHFR or mouse BICD21-572-mCherry-eDHFR using FuGENE 6 (Promega; 1 µg total DNA) and 48h prior to imaging with control siRNA using Lipofectamine RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... tissue was immediately incubated in 1% PFA (with 1 µL mL−1 RNasin Plus (Promega, cat. #N2611)) for 5 minutes at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... A polyclonal goat anti-mouse conjugated to horseradish peroxidase (1:5000, 1:10000 or 1:20000; Promega) was used as secondary antibody ...
-
bioRxiv - Biophysics 2019Quote: ... DBNL(1-256) or DBNL(1-374) using ViaFect (Promega) and assayed 24 h later ...
-
bioRxiv - Immunology 2020Quote: ... and mixed 1:1 v:v with BacTiter-Glo Reagent (Promega). The reaction was incubated for 5 min at room temperature on an orbital shaker ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mM dNTP) and 1 μl of AMV RT (Promega) was added and the sample was incubated at 42 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were lysed in 1:1 PBS:CellTiter-Glo 2.0 (Promega) reagent ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1:1 mixture of CellTiter-Glo reagent (Promega) and PBS was added to each well ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was diluted 1:1 with nuclease-free water (Promega). Quantitative real-time PCR reactions were carried out using the SYBR Green PCR master mix and ROX Passive Reference Dye (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1% Digitonin (Promega) and EDTA-free Protease Inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... 1) Trypsin (Promega) and Lys-c (Wako) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1/200 (Promega). The epidermis of WPP was dissected following fillet preparation protocols described in 32.
-
bioRxiv - Developmental Biology 2020Quote: ... (1:2000, Promega). Secondary antibodies (diluted 1:200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1:2,000 (Promega); anti-FtsZ ...
-
bioRxiv - Microbiology 2020Quote: ... duplicate wells were transfected with 1 µg HDM_Spike_RBD_B7-1 plasmids and 1 µg of Transfection Carrier DNA (Promega, E4881) using BioT reagent (Bioland Sci ...
-
bioRxiv - Molecular Biology 2023Quote: ... A polyclonal goat anti-mouse conjugated to horseradish peroxidase (1:5,000; 1:10,000; or 1:20,000; Promega, W4021) was used as the secondary antibody ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were treated with 1 μg ml-1 Proteinase K (Promega) between 1 and 20 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mM CaCl2 and 1 ug of sequence-grade trypsin (Promega) were added and incubation continued overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... a caspase-1 selective inhibitor Ac-YVAD-CHO (1 μM; Promega) was added in parallel experiments ...
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mM dNTP) and 1 μl of AMV reverse transcriptase (Promega) was then added and extension was carried out for 1 h at 42 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 1% RNAse-free BSA (Gemini) and 1:400 RNasin Plus (Promega) before storage at -80°C ...
-
bioRxiv - Microbiology 2023Quote: ... 8μl of Trypsin/LysC solution (100ng/μl 1:1 Trypsin (Promega) and LysC (FujiFilm ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 75 µL (1:1 volume) of One-Glo reagent (E6110, Promega) was added to each well and incubated for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 8μl of Trypsin/LysC solution (100ng/μl 1:1 Trypsin (Promega) and LysC (FujiFilm ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 250 µL (1:1 volume) of One-Glo reagent (E6110, Promega) was added to each well and incubated for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... each well was treated with 1:1 CellTiter-Glo (Promega, UK) and incubated for 10mins at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Subsequently Trypsin/LysC solution [100 ng/μL 1:1 Trypsin (Promega):LysC (FujiFilm ...