Labshake search
Citations for Promega :
201 - 250 of 525 citations for HCC 4 CCL16 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... for 4 h at 37 °C and then with trypsin (Promega, 1:100, w:w) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized from Gene Universal (USA) at 4°C overnight (T4 DNA ligase, Promega, USA). Cys-loop mutation ligation products were transformed into DH5α (ThermoScientific ...
-
bioRxiv - Microbiology 2024Quote: ... pH 8.0 before adding 4 µL of 0.5 µg/µL sequencing grade trypsin (Promega) and incubated over night at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... transfected with 4 µg of plasmid DNA using the FuGENE® HD Transfection (Promega) for 24 h ...
-
bioRxiv - Cancer Biology 2019Quote: ... rat or cynomolgus ICOS as target cells were co-incubated with ADCC reporter cells expressing human FcγRIIIa (V158; Promega) at a 5:1 ratio ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter area of human Rpl28 gene was cloned at HindIII/NcoI site of the pGL3-basic (Promega, E1751) to make pGL3-reporters ...
-
bioRxiv - Genomics 2022Quote: Approximately 500-bp regions of DNA containing rs80282103 and rs11154336 were amplified from purified human genomic DNA (Promega, #G1521) by PCR using engineered restriction sites to allow directional cloning into the multiple cloning region of the pGL4.23[luc2/minP] luciferase reporter vector (Promega ...
-
bioRxiv - Neuroscience 2021Quote: We constructed luciferase reporter plasmids by cloning an ∼900 bp region containing human 1b30 into the pGL4.24 vector (Promega) upstream of the minP ...
-
bioRxiv - Biophysics 2022Quote: ... pHalo-SMARCA4 expresses human SMARCA4 with HaloTag fused to the N-terminus under a CMVd1 promoter (Promega ORF FHC12075). pHalo-MED26 expresses human MED26 fused with a HaloTag at the N-terminus and was a kind gift from Joan Conaway’s lab ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Microbiology 2023Quote: ... and Sp-EVs towards human endothelial cells was accessed by the CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then resuspended in 4 ml DMEM/F12 + 80 μl DNase (1U/μl) (Promega M6101). The DNase solution was gently shaken by hand for 2–5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gel pieces were rehydrated in a mixture of 4 ng/µL trypsin (Promega, Madison, WI) and 0.01% ProteaseMAX (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by a 4 times dilution in Tris buffer and an overnight trypsin digestion (Promega) at a ratio 1/100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resuspended grindate was incubated (4°C, 20 min) with 660 U of DNase I (Promega). Insoluble cell debris was pelleted by spinning (16,000 g ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were then incubated overnight at 4 °C with anti-p75NTR (Promega; G323A; 1:300) and anti-TRADD (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Cultures were then incubated overnight at 4°C with either anti-β3-tubulin (Promega #G712A) or anti-Oct4 (Santa Cruz Biotechnologies #SC-5279 ...
-
bioRxiv - Cell Biology 2021Quote: ... Neurons were then incubated overnight at 4° C with anti-p75NTR (Promega; G323A; 1:500) and anti-TRAF6 (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C) and then resuspended in 100 µl 1 x Passive Lysis Buffer (PLB, Promega). 45 µl of the luciferase assay substrate dissolved in Luciferase Assay Buffer II was plated on a 96-well plate and 10 µl of the cell lysate was added immediately before measurement of Fluc activity using a Tecan reader ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were digested using 4 μg of trypsin (sequencing grade, low autolysis trypsin; Promega), at 37 °C for 16 h ...
-
bioRxiv - Genetics 2022Quote: ... cells were transfected with L1 reporter constructs using 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Compound treatment was initiated 1-4 hours before transfections with FuGENE HD transfection reagent (Promega) following the manual ...
-
bioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fisher) containing 4% FBS with or without HaloTag NanoBRET 618 Ligand (Cat. No. PRN1662, Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
HIVtat Alters Epithelial Differentiation State and Increases HPV16 Infectivity in Oral KeratinocytesbioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 hours incubation at 37 °C) and 5 μg of trypsin (Trypsin Gold from Promega, in 50 mM TEAB pH 8.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA (4 μg) was reverse-transcribed using oligo-dT and the Reverse Transcription System (Promega). cDNA samples were diluted 1:10 and 5 μl of each sample were used for PCR reactions (final volume of 20 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...