Labshake search
Citations for Promega :
101 - 150 of 1305 citations for Glutathione S Transferase Alpha 2 GSTA2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate obtained from each tumour sample was mixed at 1:1 ratio with the super-SILAC standard prior to FASP digestion41 with Endoproteinase Lys-C (Alpha Laboratories, UK) and trypsin (Promega, Madison, WI, USA).
-
bioRxiv - Biochemistry 2023Quote: ... The methyltransferase reaction product S-adenosylhomocysteine was quantified using MTase-Glo kit (Promega, Wisconsin, USA) following the manufacturer’s protocol (43) ...
-
bioRxiv - Cell Biology 2023Quote: ... and applied to S-Traps (micro; Protifi) for tryptic digestion (sequencing grade; Promega, Madison, WI) in 50 mM TEAB ...
-
bioRxiv - Bioengineering 2024Quote: ... The Glucose-Glo and Lactate-Glo kits (Cat #’s J6021 and J5021, Promega, Madison, WI) were used to measure the apparent glucose and lactate concentrations in media samples according to the manufacturer’s protocol ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... Sigma-Aldrich)–coated dishes or glass coverslips with 30 ng/ml of 2.5 S mouse NGF (G5141, Promega) in the Neurobasal medium containing B27 supplement (17504044 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... S-Traps were loaded with 125 μL trypsin solution (50 ng/μL in 50mM TEAB; Promega) and incubated at 47°C for 2 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) Thermolysin (Promega) or 3 ...
-
bioRxiv - Microbiology 2021Quote: ... (2) Trypsin (Promega), 4 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Erk1/2 (Promega), phospho-Erk1/2 (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... At 1 × s after injection of 20 µl of the substrate solution (Renilla Luciferase Assay System, Promega), relative light units (RLUs ...
-
bioRxiv - Immunology 2023Quote: ... VP1-3 proteins were then bound to the S-Trap column and digested with trypsin (Promega Corporation) for 2 hrs at 47°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The Nluc and BRET signals were measured (integration time: 1 s) after auto-injecting either Fz (Promega) or FFz (Promega ...
-
bioRxiv - Immunology 2024Quote: ... FC tags on the S and RBD proteins were removed through treatment with Factor Xa Proteinase (Promega).
-
bioRxiv - Cell Biology 2022Quote: ... The beads were collected by centrifugation at 8000 × g for 30 s or using a magnet separator (Promega), and washed three times with lysis buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Donor cells were co-transfected with 1.5 μg pCAGGS-S and 0,5 μg pmCherry-N1 using 6 μl of Fugene 6 following the manufacturer’s instructions (Promega). Acceptor cells were treated with CellTracker™ Green CMFDA (5-chloromethylfluorescein diacetate ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... purified protein samples were prepared by S-alkylation with iodoacetamide and digestion with either with LysC/GluC (Promega) [RBD] or ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Systems Biology 2021Quote: ... alkylated in the dark with iodoacetamide and applied to S-Traps (micro; Protifi) for tryptic digestion (sequencing grade; Promega) in 50 mM TEAB ...
-
bioRxiv - Cancer Biology 2020Quote: ... alkylated in the dark with iodoacetamide and applied to S-Traps (mini; Protifi) for tryptic digestion (sequencing grade; Promega) in 50 mM TEAB ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were cultured in Dulbecco’s modified Eagle medium (DMEM) (HyClone) with 10% fetal bovine serum FBS (HyClone) and 1% penicillin-streptomycin (P.S.) (Promega) at 37 °C in a 5% CO2 atmosphere.
-
bioRxiv - Microbiology 2023Quote: ... Sequences of all plasmids were verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Cat# 063001) with a Spectrum Compact CE System (Promega). The psPAX2-IN/HiBiT plasmid was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2023Quote: ... Enzymatic digestion and detergent removal were performed using the S-Trap device and Trypsin Gold (Promega, Madison, Wisconsin, USA) following the manufactures recommended protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were washed twice with S-Trap buffer before overnight digestion at 37° C with Trypsin (Promega Cat# V511X) in digestion buffer (50 mM ammonium carbonate ...
-
bioRxiv - Systems Biology 2023Quote: ... according to the manufacturer’s instructions and treated with 6.7 μl of DNase buffer and 10 μl of RQ1 RNase-free DNase (Promega), purified again through a p-30 column ...
-
bioRxiv - Cell Biology 2023Quote: ... H9 hESC harbouring the mitochondrial matrix mCherry-GFP flux reporter were generated by transfection of 1×105 cells with 1μg pAC150-PiggyBac-matrix-mCherry-eGFPXL (Harper’s lab) and 1μg pCMV-HypBAC-PiggyBac-Helper(Sanger Institute) in conjunction with the transfection reagent FuGENE HD (Promega). The cells were selected and maintained in TeSR™-E8™ medium supplemented with 200 mg/ml Hygromycin and Hygromycin was kept in the medium during differentiation to iNeurons ...
-
bioRxiv - Microbiology 2023Quote: ... The sequence of the plasmid was verified by sequencing using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega). To generate a pDON-5 Neo-vector expressing IFNAR1 with the W70C mutation ...
-
bioRxiv - Neuroscience 2023Quote: ... alkylated in the dark with iodoacetamide and applied to S-Traps (mini; Protifi) for tryptic digestion (sequencing grade; Promega) in 50 mM TEAB ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Immunology 2024Quote: ... RNA was subjected to reverse-transcription using GoScript reverse transcriptase primed with a mix of Oligo(dT)s (Promega) and random hexamers (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... 625 ng of lentiviral packaging vector psPAX and 625 ng of envelope vector pMD.2G (both gifts from S. Karniely, Weizmann Institute, Israel) using transfection reagent FuGene6 (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: The Cyp4p1 gene was amplified from the Canton-S antennal cDNA with primers ATGATTATCTTGTGGCTGATTCTG and AATAAGTCACGTTCGCCTCAC and then ligated into pGEM-T Easy (Promega). The vector carrying the full length Cyp4p1 insert was verified by restriction digests and sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... vortexed for 5 s and then immediately measured for luminescence (expressed as relative light units [RLU]) using a GloMax 20/20 Luminometer (Promega). All strains were tested in quadruplicate from three independent cultures.
-
bioRxiv - Microbiology 2020Quote: ... The PCR product (2.0 kb) was purified using S-400 HR columns (GE, UK) and cloned in pGEM T-Easy system (Promega, USA) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... NY) and washed with S-Trap buffer prior to overnight proteolysis at 37°C with LysC/trypsin (Promega, Madison, WI) in 50 mM ammonium bicarbonate (pH 8.0 ...
-
bioRxiv - Microbiology 2022Quote: ... and the Gaussia princeps luciferase enzymatic activity was measured on a Centro XS LB960 microplate luminometer (Berthold Technologies, reading time 10 s after injection of 50 µl Renilla luciferase reagent (Promega). For the minigenome assays ...
-
bioRxiv - Microbiology 2022Quote: ... Germany) for 2.5 s by adding 20 μL of Nano-Glo® substrate in assay buffer (Promega Inc, WI, USA). Uninfected monolayer of Vero cells treated identically served as controls to determine basal luciferase activity for obtaining normalized relative light units ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... princeps luciferase enzymatic activity due to luciferase reconstitution was measured on a Centro XS LB960 microplate luminometer (Berthold Technologies) using a reading time of 10 s after injection of 50 µl Renilla luciferase reagent (Promega). Mean relative light units (RLUs ...
-
bioRxiv - Cancer Biology 2023Quote: ... samples resuspended in 5%SDS buffer were reduced with DTT and alkylated, followed by digestion on a S-Trap column (ProtiFi, LLC)with sequencing-grade Lys-C/trypsin (Promega). The resulting peptides were were analyzed with a nanoAcquity UPLC system (Waters ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...