Labshake search
Citations for Promega :
401 - 450 of 475 citations for Ephrin type A receptor 8 EphA8 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter area of human Rpl28 gene was cloned at HindIII/NcoI site of the pGL3-basic (Promega, E1751) to make pGL3-reporters ...
-
bioRxiv - Genomics 2022Quote: Approximately 500-bp regions of DNA containing rs80282103 and rs11154336 were amplified from purified human genomic DNA (Promega, #G1521) by PCR using engineered restriction sites to allow directional cloning into the multiple cloning region of the pGL4.23[luc2/minP] luciferase reporter vector (Promega ...
-
bioRxiv - Neuroscience 2021Quote: We constructed luciferase reporter plasmids by cloning an ∼900 bp region containing human 1b30 into the pGL4.24 vector (Promega) upstream of the minP ...
-
bioRxiv - Biophysics 2022Quote: ... pHalo-SMARCA4 expresses human SMARCA4 with HaloTag fused to the N-terminus under a CMVd1 promoter (Promega ORF FHC12075). pHalo-MED26 expresses human MED26 fused with a HaloTag at the N-terminus and was a kind gift from Joan Conaway’s lab ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Microbiology 2023Quote: ... and Sp-EVs towards human endothelial cells was accessed by the CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... and SERBP1 were amplified from human cDNA and cloned into the appropriate vectors (pACT or pBIND) provided by the CheckMate Mammalian Two-Hybrid kit (Promega E2440). The appropriate combination of edited pACT and pBIND vectors ...