Labshake search
Citations for Promega :
51 - 100 of 4476 citations for DHEA S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... the test plate was inserted in the plate reader GloMAX discover (Promega) to measure the luminescence by VSC stimulation ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 5× Gotaq buffer (Promega M792A), 1μl of 10μM forward primer ...
-
bioRxiv - Biophysics 2022Quote: ... transient transfection of the appropriate plasmid(s) was performed using FuGENE HD (Promega) according to the manufacturer’s procedure ...
-
bioRxiv - Immunology 2023Quote: ... and applied to S-Traps (mini; Protifi) for tryptic digestion (sequencing grade; Promega) in 50 mM TEAB ...
-
bioRxiv - Immunology 2024Quote: ... and applied to S-Traps (mini; Protifi) for tryptic digestion (sequencing grade; Promega) in 50 mM TEAB ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed on the plate and incubated with luminescence glo regents per the luminescence glo assay kit’s instructions (Promega). Luminescence was recorded using a BioTek Synergy2 plate reader.
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... 5 µL of RNA was used for each cDNA synthesis (GoScript™ Reverse Transcription System kit, Promega). qPCR was performed using Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... Luminescence was measured using a plate reader (Promega, GloMax Discover plate reader, GM3000). Relative viability was calculated by dividing luminescence values for each replicate by mean luminescence of media control for each experiment.
-
bioRxiv - Microbiology 2020Quote: ... Luciferase intensity was measured with a GloMax luminometer (10-s signal integration; Promega BioSystems).
-
bioRxiv - Microbiology 2023Quote: ... The plate was read with a plate reader (GloMax® Discover Microplate Reader (Promega) or CLARIOstar Plus Microplate Reader (BMG Labtech) ...
-
bioRxiv - Biochemistry 2019Quote: ... The luminescence signal was developed for 20 min after adding 40 µl kinase detection reagent (kit) and measured with a GloMaxMulti plate reader (Promega). The average of three experiments performed in duplicate and normalized to PI3KC3-C1 activity were determined ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were seeded in 96 wells plate and luciferase activities were measured using Dual-Luciferase Reporter Assay System kit as described by the manufacture (Promega). Fluc/Rluc ratios were determined as relative luciferase activities.
-
bioRxiv - Cancer Biology 2022Quote: ... for 72 hours and cell proliferation was assayed using the CellTiter 96 Non-Radioactive Cell Proliferation kit and a GloMax Discovery plate reader (Promega). For proteomic mass spectrometry ...
-
bioRxiv - Biochemistry 2023Quote: Cells were grown in opaque 96-well white plates and then processed according to the manufacturer’s instructions of the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega # G9241). The standard curve of ATP was determined in parallel for absolute quantitation.
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from overnight cultures on GCB agar plates with appropriate components using Wizard Genomic DNA purification kit (Promega) following manufacturer instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... lactate assay was performed using 5 μl of media and the luminometric Lactate-Glo assay kit (Promega, # J5021) according to the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Subsequent measurements were taken every 24 hrs for 5 days using CellTiterGlo Luminescent Cell Viability Assay kit (Promega) and SpectraMax plate reader (Molecular Devices ...
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized to mock-treated ...
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized by subtracting Gluc signal from mock-infected cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which the plate is read for luciferase signal using GloMax Explorer Plate Reader (Promega). For each ratio (CAR-T ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read at a wavelength of 450nm with a Glomax plate reader (Promega). Toxin concentration in each sample was calculated using the standard curve and normalized by the optical density of the culture ...
-
bioRxiv - Cell Biology 2023Quote: ... and applied to S-Traps (micro; Protifi) for tryptic digestion (sequencing grade; Promega, Madison, WI) in 50 mM TEAB ...
-
bioRxiv - Biochemistry 2022Quote: Intracellular glutamate was measured in chondrocytes in 96 well plate format utilizing Glutamate-Glo assay kit (J7021, Promega, Madison, WI USA). Luminescence was measured on microplate reader ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... H12) of each 96 well plate were pooled prior to DNA extraction using Wizard Genomic DNA purification kit (Promega, Madison, Wisconsin). The P0 region including the beginning of galK was amplified for 25 PCR cycles using primers deep_seq_Fw and deep_seq_Rv carrying 5’ adaptors for Illumina sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Cell Biology 2023Quote: ... was added to the wells and the plate was introduced into the GloMax plate reader (Promega). The first 7 minutes absorbance was measured at 560nm every minute for baseline pH calibration ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... on the GloMax plate reader (Promega). Each oligo was tested using two biological replicates on different days and each biological replicate consisted of three technical replicates ...
-
bioRxiv - Microbiology 2020Quote: ... and a Glowmax plate luminometer (Promega).
-
bioRxiv - Immunology 2021Quote: ... using a Glomax plate reader (Promega). Measurements were performed in duplicate and used to calculate 50% inhibitory concentrations (IC50 ...
-
bioRxiv - Neuroscience 2023Quote: ... obtained using GLoMax plate reader (Promega), was interpolated against the standard curve to calculate the neurotrophin concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... abd a GloMax plate-reader (Promega). Samples were prepared by boillling with 2x Laemmli sample buffer (BioRad ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a GloMax+ plate reader (Promega).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... deep 96 well plate (V6771, Promega) in darkness in a 28°C incubator for 24 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... with a GloMax plate reader (Promega). Firefly luciferase activities were normalized based on the Renilla luciferase activity in each well.
-
bioRxiv - Bioengineering 2024Quote: ... or a GloMax Plate Reader (Promega). Percent infection was calculated using background-subtracted signals from wells containing virus only as a 100% infection reference ...
-
bioRxiv - Bioengineering 2024Quote: ... or a GloMax Plate Reader (Promega). The concentrations of the samples were determined by extrapolation from a standard curve made with a four-parameter nonlinear regression model in Prism.
-
bioRxiv - Genetics 2024Quote: ... and Glomax Discover plate reader (Promega). The measurement was performed every 24 hours starting from the day after seeding (24h ...
-
bioRxiv - Neuroscience 2020Quote: The toxicity of PX was investigated on monolayers of BLEC seeded on 96 well plates or on inserts luminal side in co-culture experiments using the commercially available Cytotoxicity Detection Kit (Promega, United States). An aliquot of 25 μl medium was taken to quantify the lactate dehydrogenase (LDH ...
-
bioRxiv - Synthetic Biology 2023Quote: ... lysed with 1X Passive Lysis Buffer then analysed using the Dual-Luciferase Assay kit on a GloMax multi+ plate reader (Promega, Southampton, UK).
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... Sigma-Aldrich)–coated dishes or glass coverslips with 30 ng/ml of 2.5 S mouse NGF (G5141, Promega) in the Neurobasal medium containing B27 supplement (17504044 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... S-Traps were loaded with 125 μL trypsin solution (50 ng/μL in 50mM TEAB; Promega) and incubated at 47°C for 2 hours ...
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...