Labshake search
Citations for Promega :
401 - 450 of 748 citations for Cytokeratin 7 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Neuroscience 2020Quote: ... after which beads were washed with 1X High Salt Wash Buffer(50mM Tris-HCl pH 7.4, 350mM NaCl, 1%NP-40 and 1 unit/ul Promega recombinant RNAsin). In the last wash ...
-
bioRxiv - Biochemistry 2021Quote: ... RRL were incubated for 5 min at 30°C then 10 min on ice with buffer containing 1U/μl of recombinant RNasin (Promega®), 75 mM KCl 0.5 mM MgCl2 ...
-
bioRxiv - Biophysics 2023Quote: ... The initial recombinant baculovirus was generated by transfecting adherent Sf9 cells with the bacmid DNA using the FuGENE HD reagent (Promega, USA) and used to infect suspension cells for virus amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... The katna1 digoxigenin-labelled sense and antisense riboprobes were synthetized from the linearised recombinant TOPO® TA cloning vector using T7 and T3 RNA Polymerase (Promega) according to the supplier’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Lumit anti-rabbit antibody-SmBiT (Promega). Final concentration of each antibody is 0.15 μg ml−1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Goat anti-rabbit IgG-HRP (W401B, Promega); Horse anti-mouse IgG-HRP (PI2000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-Halotag (Promega, G9281, 1:500), rabbit anti-Sox2 (Abcam ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated with rabbit or mouse (Promega) HRP-conjugated secondary antibody diluted 1:4000 in 5 % milk powder in TBST for 45 min and washed again ...
-
bioRxiv - Developmental Biology 2019Quote: ... Rabbit monoclonal anti-pJNK (1:100; Promega) or rat anti-Dilp8 (1:50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-β-Galactosidase (1:1500; Promega), mouse anti-β-Galactosidase (40-1a ...
-
bioRxiv - Microbiology 2021Quote: ... a rabbit reticulocyte lysate (Promega, Cat: L4151) was thawed at 37°C immediately before use and supplemented with 40 μl of 1 mM hemin stock solution and 10 μl of 1 M creatine phosphate (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Rabbit reticulocyte lysates were obtained from Promega. For each experimental replicate ...
-
bioRxiv - Plant Biology 2019Quote: ... and with anti-rabbit-HRP (W4011, Promega). Detection of tagged proteins was carried out in blocking solution (5% fat-free milk ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-rabbit IgG horseradish peroxidase conjugate (Promega), anti-mouse IgG horseradish peroxidase conjugate (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... and anti-Rabbit IgG HRP Conjugate (Promega) secondary antibodies.
-
bioRxiv - Physiology 2021Quote: ... anti-rabbit or anti-mouse HRP (Promega) was diluted in TBS containing 0.05% Tween-20 and 5% dry nonfat milk ...
-
bioRxiv - Cancer Biology 2021Quote: ... Anti-rabbit IgG HRP conjugate (Promega, W401B) was used to visualize bands with Amersham ECL Western Blotting Detection Reagents (Cytiva ...
-
bioRxiv - Biochemistry 2022Quote: ... or Goat anti-Rabbit IgG (W401B, Promega) secondary antibodies for 1 hour (h) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or rabbit IgG (cat. no. W401B; Promega). Protein signals were visualized using an iBright CL1500 Imaging system (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the G9281 rabbit anti-HaloTag antibody (Promega) was used at a dilution in the range of 1:30 to 1:500 (1:500 is the working dilution for immunofluorescence).
-
bioRxiv - Cell Biology 2023Quote: ... anti-rabbit IgG (Promega, W4011, 1:5000) or anti-mouse IgG (Promega ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-rabbit IgG (Promega, 1:20,000), goat anti-rat IgG + IgM (L+M ...
-
bioRxiv - Developmental Biology 2024Quote: ... and anti-rabbit HRP conjugate (Promega, W4018). Alexa Fluor-conjugated secondary antibodies for immunofluorescence staining were purchased from Invitrogen.
-
bioRxiv - Developmental Biology 2024Quote: ... and anti-rabbit HRP conjugate (Promega, W4018)).
-
bioRxiv - Cell Biology 2024Quote: ... rabbit (CST 7074S) or chicken (Promega G135A) in TBST containing 1% BSA for 1 hour at room temperature on shaker ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The recombinant plasmid was digested with Sac1 and Nde1 restriction enzyme and sub-cloned in pGL3 Basic luciferase vector (Promega, Madison, USA).
-
bioRxiv - Biochemistry 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (MMLV-RT) enzyme and recombinant RNasin® ribonuclease inhibitor were purchased from Promega (Madison, WI, USA). Evagreen 2X qPCR MasterMix was purchased from Applied Biological Materials Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... the cytosol of the semi-intact cells was replaced by rabbit reticulocyte lysate (Flexi Rabbit Reticulocyte Lysate System, Promega) and mRNA was translated for 1 hour at 30 °C in presence of 10 µCi/µL EasytagTM 35S Express Protein Labeling Mix (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2021Quote: ... Pull down assays were performed utilizing myc-tagged proteins that were generated from recombinant pGBKT7-derivatives through in vitro transcription/translation using wheat germ extract (cat# L4330, Promega, Madison, WI, USA)(Stephan et al. ...
-
bioRxiv - Microbiology 2023Quote: ... As a qPCR standard the recombinant plasmid pBELX-1 (Bellanger et al., 2014) was extracted using the Wizard plus SV Miniprep DNA Purification System (Promega, Madison, WI, USA) according to the manufacturers’ instructions and linearized by restriction enzyme BamHI (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Experiments using nuclease-treated Rabbit Reticulocyte Lysates (Promega) were performed by supplementing the reactions as above at 37°C for 30 minutes following the manufacturer guidelines.