Labshake search
Citations for Promega :
1 - 50 of 2385 citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
bioRxiv - Immunology 2024Quote: ... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
bioRxiv - Microbiology 2024Quote: ... the MTS solution (3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (Promega # G3581) was added to individual wells ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) inner salt (Promega) was added to each well and the plate was further incubated for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μL of [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) (Promega, #G3582) were added and incubated at 37°C for 3 hours ...
-
bioRxiv - Plant Biology 2022Quote: ... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Bioengineering 2023Quote: ... The effect on cell viability of PTNP was assessed using the MTS [(3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium)] assay (CellTiter 96 cell proliferation assay kit; Promega, WI, USA) (92) ...
-
bioRxiv - Biochemistry 2023Quote: ... MTS ([3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (#G3581) was purchased from Promega (Charbonnières-les-Bains, France).
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Bioengineering 2020Quote: The therapeutic effect of free taxane (pro)drugs and LNP formulations was determined by the [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) or the resazurin-based PrestoBlue assay (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 175 μg/ml 5-bromo-4-chloro-3- indolyl-phosphate (BCIP) (Promega). Reactions were stopped as the signal became apparent with three PBS rinses ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell numbers were quantified using a colorimetric 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfo-phenyl)-2H-tetrazolium (MTS) assay (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega, Madison, WI, USA). Ramos cells were seeded in 96-well plates at density of 105 cells/well and incubated for 48 h prior to experimental treatments ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were incubated in a 0.165 mg/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate, Promega)/ 0.33 mg/ml NBT (p-nitroblue tetrazolium chloride ...
-
bioRxiv - Microbiology 2021Quote: ... 4 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Genetics 2024Quote: ... using primers 5’-TCCCTTCCTTCAAGGCTACA-3’ and 5’-GTTAGGAGCCAGAGCAGCAC-3’ and the Go-Taq Flexi DNA Polymerase (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... immunoreactive bands were detected using nitroblue tetrazolium–5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Promega, Madison, WI, USA), for human cells and mBMDM ...
-
bioRxiv - Cell Biology 2024Quote: ... Reagents 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) were from Promega (Madison, WI). The inhibitors of protein synthesis cycloheximide (CXH) ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Cell viability was assessed after 2 and 5 days (i.e., 3 and 6 days post-treatment) using CellTiter-Glo (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Cell Biology 2023Quote: Protein-protein interactions between Mkl1/2 and Foxo1/3/4 or glucocorticoid receptors were also measured using NanoBiT PPI Starter Systems (Promega). 293FT cells were seeded in 96-well white wall microplates and co-transfected with the LgBiT and SmBiT plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Physiology 2024Quote: ... The locus containing the rdu14 allele was amplified by PCR, using the following primers (Forward: 5’-TGATTCACACTACTTACTTGTCTAG-3’, Reverse: 5’-GATTAAAAGTAGTTATCTCATCCTCAG-3’) and GoTaq polymerase (Promega, ). The genotype of the locus was scored after resolving samples on 2.5% agarose gels as HNF4α+/+ ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Microbiology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based viability assay (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega) was performed as previously described (25).