Labshake search
Citations for Promega :
51 - 100 of 4425 citations for Cyclic GMP Direct ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Subsequent measurements were taken every 24 hrs for 5 days using CellTiterGlo Luminescent Cell Viability Assay kit (Promega) and SpectraMax plate reader (Molecular Devices ...
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized to mock-treated ...
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized by subtracting Gluc signal from mock-infected cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which the plate is read for luciferase signal using GloMax Explorer Plate Reader (Promega). For each ratio (CAR-T ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read at a wavelength of 450nm with a Glomax plate reader (Promega). Toxin concentration in each sample was calculated using the standard curve and normalized by the optical density of the culture ...
-
bioRxiv - Biochemistry 2022Quote: Intracellular glutamate was measured in chondrocytes in 96 well plate format utilizing Glutamate-Glo assay kit (J7021, Promega, Madison, WI USA). Luminescence was measured on microplate reader ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... H12) of each 96 well plate were pooled prior to DNA extraction using Wizard Genomic DNA purification kit (Promega, Madison, Wisconsin). The P0 region including the beginning of galK was amplified for 25 PCR cycles using primers deep_seq_Fw and deep_seq_Rv carrying 5’ adaptors for Illumina sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Microbiology 2019Quote: ... Parasites viability was assessed by direct light microscope observations and MTS colorimetric assays (CellTiter Aqueous One Solution Cell Proliferation Assay -Promega); they maintained shape and motility at 5 ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Cell Biology 2023Quote: ... was added to the wells and the plate was introduced into the GloMax plate reader (Promega). The first 7 minutes absorbance was measured at 560nm every minute for baseline pH calibration ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... on the GloMax plate reader (Promega). Each oligo was tested using two biological replicates on different days and each biological replicate consisted of three technical replicates ...
-
bioRxiv - Microbiology 2020Quote: ... and a Glowmax plate luminometer (Promega).
-
bioRxiv - Immunology 2021Quote: ... using a Glomax plate reader (Promega). Measurements were performed in duplicate and used to calculate 50% inhibitory concentrations (IC50 ...
-
bioRxiv - Neuroscience 2023Quote: ... obtained using GLoMax plate reader (Promega), was interpolated against the standard curve to calculate the neurotrophin concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... abd a GloMax plate-reader (Promega). Samples were prepared by boillling with 2x Laemmli sample buffer (BioRad ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a GloMax+ plate reader (Promega).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... deep 96 well plate (V6771, Promega) in darkness in a 28°C incubator for 24 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... with a GloMax plate reader (Promega). Firefly luciferase activities were normalized based on the Renilla luciferase activity in each well.
-
bioRxiv - Bioengineering 2024Quote: ... or a GloMax Plate Reader (Promega). Percent infection was calculated using background-subtracted signals from wells containing virus only as a 100% infection reference ...
-
bioRxiv - Bioengineering 2024Quote: ... or a GloMax Plate Reader (Promega). The concentrations of the samples were determined by extrapolation from a standard curve made with a four-parameter nonlinear regression model in Prism.
-
bioRxiv - Genetics 2024Quote: ... and Glomax Discover plate reader (Promega). The measurement was performed every 24 hours starting from the day after seeding (24h ...
-
bioRxiv - Neuroscience 2020Quote: The toxicity of PX was investigated on monolayers of BLEC seeded on 96 well plates or on inserts luminal side in co-culture experiments using the commercially available Cytotoxicity Detection Kit (Promega, United States). An aliquot of 25 μl medium was taken to quantify the lactate dehydrogenase (LDH ...
-
bioRxiv - Synthetic Biology 2023Quote: ... lysed with 1X Passive Lysis Buffer then analysed using the Dual-Luciferase Assay kit on a GloMax multi+ plate reader (Promega, Southampton, UK).
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).
-
bioRxiv - Microbiology 2024Quote: The direct antiviral effect of betacyanin fractions was evaluated through the formation of viral CPE using the Viral ToxGloTM Assay (Promega, USA) per the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfected cells plated in 96-well black plates were examined using a CellTiter-Blue Cell Viability Assay kit (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... with m7G(5')ppp(5')G RNA Cap Structure Analog (ref. S1404L, Promega) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200µL (for 48-well plate format) or 400µL (for 24-well plate format) complete DMEM with or without 10µM furimazine (Promega). Cells were incubated at 37°C under 5% CO2 either in the dark ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The α-tub∷GFP (Chung et al., 2014) plasmid was injected at 5-10ng/μl after purification using the PureYield Midiprep kit (Promega, #A2492).
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 5 mL of overnight cultures using the Wizard Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) and DNA concentration was measured using a Qubit™ Fluorometer and Nanodrop 2000 (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 min while orbital shaking and using 20 μL of lysate with 20 μL of Luciferase Kit substrate (Promega, E1501).
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were cultured for another 5 days before proceeding with microscopy image and viability test by CellTiter-Glo 3D kit (Promega: G9681) following manufacturer’s instructions.