Labshake search
Citations for Promega :
1 - 50 of 5720 citations for Cow Upstream stimulatory factor 1 USF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... and cloned into upstream of the minimal promoter in pGL4.23 (Promega, E841A) with XhoI and BglII ...
-
bioRxiv - Microbiology 2020Quote: ... The standard was created with above-mentioned primers by amplifying mcrA genes from cow rumen fluid [19] and cloning them into the pGEM®-Teasy vector system (Promega, Mannheim, Germany). Amplicons for mcrA standard were generated with vector-specific primers sp6 and T7 and the resulting PCR product was cleaned with DNA purification kit (Biozym ...
-
bioRxiv - Molecular Biology 2020Quote: ... The BRE was cloned upstream of a destabilized form of NanoLuc Luciferase (Promega) containing a C-terminal protein degradation sequence (PEST sequence ...
-
bioRxiv - Immunology 2023Quote: ... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
bioRxiv - Neuroscience 2022Quote: ... and cloned into pGL3-Firefly luciferase upstream of the SV40 promoter (pGL3-luc; Promega) using a Gibson assembly kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Microbiology 2022Quote: ... Primers flanking the upstream and downstream regions of each gene of interest were amplified from PA14 genomic DNA (Promega Wizard Genomic DNA Purification Kit) and extracted with GeneJet Gel Extraction Kit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... upstream of a luciferase reporter molecule in the context of a pGL3 plasmid (Promega, E1751). Plasmids designed for whole zebrafish injection were generated by replacing the firefly luciferase reporter with an enhanced green fluorescent protein (eGFP ...
-
bioRxiv - Cell Biology 2021Quote: The HSV-TK promoter was cloned upstream of luciferase in the pGL4.10[luc2] plasmid (Promega). A 122 bp region of the E2f7 promoter or a 2.1kb region of the E2f8 enhancer was cloned into the XhoI site upstream of the HSV-TK promoter ...
-
bioRxiv - Immunology 2023Quote: ... was inserted upstream of the luc2 gene in the pGL4.10[luc2] plasmid (Promega Cat. E6651). As the SNP was located within the promoter region ...
-
bioRxiv - Immunology 2023Quote: ... was inserted upstream of the luc2 gene in the pGL4.10[luc2] plasmid (Promega Cat. E6651). Following this step ...
-
bioRxiv - Cell Biology 2021Quote: The upstream region of myogenin (−1650/+51) was PCR-amplified and clonedinto the pGL4.20 vector (Promega). The hnRNPK-expressing plasmid was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI, Promega AG, Dübendorf, CH) and subsequent ligation (Rapid DNA Ligation Kit ...
-
bioRxiv - Biochemistry 2021Quote: ... we introduced an EcoRI restriction site upstream of hRLuc-neo fusion sequence in pmirGLO vector (Promega®) using Quick Change site-directed mutagenesis kit II XL (Thermo Fischer Scientific®) ...
-
bioRxiv - Genetics 2024Quote: ... were cloned upstream of a minimal promoter driven firefly luciferase reporter gene in the pGL4.23 vector (Promega). Existing plasmids constructs of variant-centered test elements for the five variants of interest (see Dataset S1 for genomic regions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Cell Biology 2020Quote: ... CBS1 and CBS2 of CCAT1 and E2F1-CBS upstream of E2F1 were amplified from HCT116 genome and inserted into pGL4.27 and pGL4.11 (Promega) in the sense orientation relative to the luciferase coding sequence ...
-
bioRxiv - Cancer Biology 2021Quote: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene (LGALS1 pGL4.23 ...
-
bioRxiv - Developmental Biology 2021Quote: ... A 2kb DNA fragment upstream of TSS of Snail1 promoter (ENSGAL00000008018) was cloned into pGL3 basic plasmid (Promega) using PWO polymerase (Roche ...
-
bioRxiv - Genetics 2020Quote: ... was cloned into upstream of the firefly (Photinus pyrails) luciferase gene in pGL4.23 vector (GenBank Accession Number DQ904455.1, Promega) and verified that it has constitutive activity but is not hyperosmotically inducible ...
-
bioRxiv - Cell Biology 2022Quote: ... and cloned upstream of the luciferase coding sequence of the pGL3-Basic plasmid (Promega, Madison, WI, USA, # E1751). The SAM68 expression plasmid was generated by insertion of the complete SAM68 coding sequence ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Jurkat T cells overexpressing hPD-1 and carrying a luciferase reporter gene under the control of Nuclear Factor of Activated T-cells Response Element (NFAT-RE) (hPD-1 Effector Cells, hPD-1 ECs, Promega) were cultured in RPMI-1640 medium (Biowest ...
-
bioRxiv - Cell Biology 2019Quote: ... was amplified from mouse genomic DNA and cloned upstream of luciferase cassette in KpnI/HindIII site of pGL4.23 (Promega) using primers listed in Supplementary table 1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... tropicalis Pax8-CNS1 sequence was removed from the 1pax8-pax8(-2038)-GFP construct (Ochi et al., 2012) with bamH1 and inserted upstream of the basal promoter of pGL4.23[luc2]miniP (PROMEGA) to generate pax8CNS1-luc ...
-
bioRxiv - Microbiology 2022Quote: ... was amplified from genomic DNA using primers MWV524 and MWV525 (Table S2) and introduced upstream of the nanoluciferase gene in the commercially available vector pNL1.1 (Promega) by XhoI/NcoI restriction digestion and ligation ...
-
bioRxiv - Cancer Biology 2019Quote: ... These fragments were cloned upstream of the SV40 minimal promoter into the pGL3 luciferase reporter vector (Promega, #E1761, Germany) by In-Fusion HD Cloning Kit (Clontech ...
-
bioRxiv - Genomics 2019Quote: ... We cloned sequences containing reference alleles in the forward orientation upstream of the minimal promoter of firefly luciferase vector pGL4.23 (Promega) using KpnI and SacI restriction sites ...
-
bioRxiv - Genetics 2021Quote: ... we cloned human DNA sequences (Coriell) containing the reference or alternate allele upstream of the minimal promoter in the luciferase reporter vector pGL4.23 (Promega) in the forward direction using the restriction enzymes SacI and KpnI ...
-
bioRxiv - Genomics 2020Quote: ... we cloned human DNA sequences (Coriell) containing the reference allele upstream of the minimal promoter in the luciferase reporter vector pGL4.23 (Promega) using the enzymes Sac I and Kpn I ...
-
bioRxiv - Neuroscience 2023Quote: ... A 9.5 kb fragment containing upstream promoter region of mouse Frizzled10 (Fzd10) gene was subcloned into pGEM vector (Promega). CreERT2gene (Feil et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... gBlocks were inserted using sequence-and ligase-independent cloning (58) upstream of the coding sequence for a secreted nano-luciferase following digestion of vector pNL2.3 (Promega) using EcoRV and HindIII ...
-
bioRxiv - Immunology 2023Quote: HIC1 binding on RUNX1 promoter was assessed using Dual-Luciferase® Reporter Assay by cloning the ChIP-defined genomic region upstream of a minimal promoter driving a luciferase gene (pGL4.10 [luc2/minP]; Promega). Wild type HIC1 binding motif of the RUNX1 proximal promoter (5′-TGCCCTGG-3′ ...
-
bioRxiv - Physiology 2023Quote: ... 25 ng/mL fibroblast growth factor (bFGF; Promega), 1% penicillin streptomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... A direct cAMP ELISA kit (Enzo) was used in endpoint experiments and the pGloSensor (−20F) luminescence assay (Promega) was used for kinetic cAMP measurements ...
-
bioRxiv - Molecular Biology 2021Quote: ... with upstream primer UG5953 and downstream primers YA9566 (100 bp) or YA9567 (200 bp) and ligated into pGEM-Teasy (Promega) to create pCB4633 and pCB4634 ...
-
bioRxiv - Cell Biology 2019Quote: A DNA fragment of Il24 (−1036 ∼ −598 bp in the upstream of transcription start site) was subcloned into a luciferase reporter vector pGL4 (Promega). AML12 cells were cultured in 24- well plates for 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... or four NF-κB target sites followed by an Hspa1a promoter were designed with flanking NheI-NcoI restriction sites and then cloned upstream of the luciferase gene in the pGL3 luciferase reporter plasmid at the NheI-NcoI sites (Promega). Jurkat cells were transfected with pBluescript II SK(+ ...
-
bioRxiv - Genetics 2020Quote: ... double-stranded DNA oligos containing KRAB-ZFP target sequences (Supplemental Table 5) were cloned upstream of the SV40 promoter of the pGL3-Promoter vector (Promega) between the restriction sites for NheI and XhoI ...
-
bioRxiv - Genetics 2020Quote: ... The DNA fragments were cloned into upstream of firefly luciferase through Xho1 and Kpn1 in pGL3-basic vector (Promega, E1751). For enhancer activity assay ...
-
bioRxiv - Genomics 2019Quote: The 5’ UTR sequence from the major and minor promoters of ZNHIT1 was cloned upstream of Luciferase gene in HindIII/NcoI digested pGL3 vector (Promega). Then ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with restriction enzyme overhangs were ordered from Genewiz and cloned into pGL3-basic plasmid upstream of the firefly reporter gene (E1751, Promega). Minipreps were prepared with QIAprep Spin Miniprep kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The BRE response element was inserted upstream of the minimal promotor region of plasmid pGL4.26 luc2/minP/Hygro (Promega E8441) that also encodes the luciferase reporter gene luc2 ...
-
bioRxiv - Microbiology 2022Quote: ... carrying 6 copies of the HNF4 transcriptional response element upstream of a secreted Gaussia luciferase (Gluc) reporter gene was transfected (FuGENE, Promega) into confluent Caco-2 cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... VA or Mutated (M)-sequences with the corresponding complementary strands (Supplementary Table S1) and then cloned using SmaI restriction site upstream the basal SV40 promoter into pGL3-promoter vector plasmid (Promega), in the same strand (coding or template ...
-
bioRxiv - Immunology 2022Quote: ... was generated by cloning the regulatory region of Ikzf4 (2 kb upstream of the transcriptional start site) into the pGL3-Basic vector (Promega). EL4 T cells were nucleofected in combination with either a STAT5BCA ...
-
A systematic approach identifies p53-DREAM target genes associated with blood or brain abnormalitiesbioRxiv - Genetics 2023Quote: ... a 1-1.5 kb fragment of the promoter containing at its center the putative DBS was cloned upstream a luciferase reporter gene in the backbone of a PGL3 basic vector (Promega). For all tested DBS ...
-
bioRxiv - Microbiology 2023Quote: ... The kan gene was then inserted between the upstream and downstream 05515-05525 flanking PCR fragments and simultaneously inserted into the pGEM-7Zf vector (Promega) in the BamHI and XhoI sites using the In-Fusion kit according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... A 240 base pair sequence of the human gastrin gene [25] was cloned upstream of the firefly luciferase-encoding sequence in the pGL3B reporter plasmid (Cat #E1751, Promega). Upon reaching 60–75% confluency in 6-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... was cloned upstream a SV40 minimal promoter and a luciferase reporter gene in the backbone of a PGL3 plasmid (Promega). We used lipofectamine 2000 to transfect p53-/- MEFs with 2 μg of either luciferase expression vector ...
-
bioRxiv - Biophysics 2022Quote: ... Factor Xa protease (SKU PR-V5581, Promega, Madison, WI) was used to cleave MBP-Q44-HttEx1 at 22 °C (Boatz et al. ...