Labshake search
Citations for Promega :
401 - 450 of 3612 citations for Alpaca ZAP Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and rabbit anti-Caspase-3 polyclonal antibody (1:250, Promega/Fisher, PR-G7481) overnight at 4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... incubated with the secondary antibody rabbit anti chicken IgY HRP [(Promega Corporation, G1351) 1:10000] for 2 h and again washed three times ...
-
bioRxiv - Developmental Biology 2023Quote: ... We used the following primary antibodies: mouse anti-LacZ (1:500 dilution, Promega) rabbit polyclonal anti-cleaved Caspase 3 (1:200 dilution ...
-
bioRxiv - Genomics 2024Quote: ... Membranes were then incubated with 1:10000 HRP-conjugated secondary antibody (Promega #W402B) in TBST + 5% milk for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibody against HaloTag® (G9211; 1:1000) was purchased from Promega (UK).
-
bioRxiv - Genomics 2021Quote: ... DNA was quantified using both the Qubit dsDNA HS Assay Kit on the Qubit 3.0 Fluorometer and the Plexor HY DNA Quantification Kit (Promega Corporation, Madison, WI) prior to submission for microarray genotyping.
-
bioRxiv - Biochemistry 2023Quote: ... The P450-Glo CYP1A1/1B1 assay kit and NADPH regeneration system and luciferase assay kit were purchased from Promega (Promega, Madison, WI) and utilized under the following conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from FFPE blocks using either the Qiagen AllPrep® DNA/RNA FFPE kit for FFPE-derived samples or using the Maxwell® RSC FFPE Plus DNA Kit (Promega). For frozen blocks ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA/Protein Purification Plus kit (Norgen, Thorold, ON, Canada) or the Maxwell 16 LEV simplyRNA purification kit (Promega, Madison, WI, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2023Quote: The NAD/NADH-Glo™ Assay kit (#G9071, LOT: 0000469987) and the NADP/NADPH- Glo™ Assay kit (#G9081, LOT: 0000472344) were purchased from Promega. Vacor (Pyrinuron N- 13738 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated using genomic DNA extracted with Puregene Gentra Kit and multiplexed using the Promega Geneprint Kit and multiplexed with a STR-based method (Promega Geneprint System). Samples were run on an Applied Biosystems 3130xl DNA analyser and the results analysed using the Applied Biosystems Genemapper v4.1 software ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized with the ImProm II Kit (Promega). qPCR was performed using the Brilliant III Ultra-Fast SYBR® Green QPCR Master mix reagents (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with a reverse-transcriptase kit (Promega). RNA of cells exposed to SARS-CoV-2 WT was isolated with the QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... and LEV DNA kit (AS1290, Promega, Madison, WI, US). The filters with collected biomass in lysing matrix E tubes were incubated with 300μL of lysing buffer and 30μL of Proteinase K and incubated at 56°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... luciferase signal was quantified using the DualGlo kit (Promega). Each experiment was performed in triplicate with two biological replicates ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Bactiter-Glo microbial cell viability assay kit (Promega) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... was subjected to poly(A)+tract isolation kit (Promega). Poly(A)+ enriched RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... According to the instructions of the detection kit (Promega), the cells were transfected with the luciferase reporter gene level plasmid ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using the Reverse Transcription kit (Promega). Transcriptional levels of IFN-β ...
-
bioRxiv - Microbiology 2019Quote: ... followed by 350 μL RNA Dilution Buffer (Promega kit) were added to the cell suspensions ...
-
bioRxiv - Genomics 2019Quote: ... with a GoTaq® qPCR master mix kit (Promega). We used two technical replicates for each biological replicate ...
-
bioRxiv - Developmental Biology 2019Quote: ... Luminescence was measured following the kit protocol from Promega.
-
bioRxiv - Biochemistry 2020Quote: ... The pGEM-T Vector kit was purchased from Promega. Acrylamide/bisacrylamide (29:1 ...
-
bioRxiv - Microbiology 2019Quote: ATP was estimated using the BacTiter-Glo kit (Promega). For BDQ or INH treatments in MMA ...
-
bioRxiv - Cell Biology 2019Quote: ... and subsequently analyzed using the GoTaq Green kit (Promega) for analytical RT-PCRs with the primers listed in the Key Resources Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... Maxwell RSC DNA FFPE Kit (Promega Maxwell® RSC), PerkinElmer chemagic FFPE DNA kit (chemagic MSM 1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Genetics 2019Quote: ... using in situ DeadEnd Fluorometric detection kit (G3250-PROMEGA) according to technical protocol (#TB235) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
Cytoplasm localized ARID1B promotes oncogenesis in pancreatic cancer by activating RAF-ERK signalingbioRxiv - Cell Biology 2019Quote: Halo tag (Halo pulldown and labeling kit, Promega Corporations) and Streptavidin bead (GE Health care Bio-Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... The dual luciferase assay kit (Promega, Madison, WI, USA) and Glomax 96 Microplate Spectrophotometer (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured by luciferase assay kit (Promega) using an LMaxII™ microplate luminometer (Molecular Devices) ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were authenticated using the GenePrint10 kit (Promega) and matching to their original profiles (ATCC) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Neutralization was measured with a luciferase assay kit (Promega) and plotted relative to the value for control wells.
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cell Biology 2020Quote: A GenePrint 10 System PCR Amplification kit (Promega Corporation) was used to determine the genetic signature of both samples based on the multiplex analysis of 9 loci and the Amelogenin sex-determining marker ...
-
bioRxiv - Cancer Biology 2019Quote: ... Dual-luciferase reporter gene assay kit (Promega, Beijing, China) was used to measure activities of Luciferase ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Cell Titer Glo Luminescent Cell Viability Assay Kit (Promega) was used and subsequently performed after the BRET measurement ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...