Labshake search
Citations for Promega :
201 - 250 of 1825 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Denatured proteins were digested with chymotrypsin (Promega) at 1:100 (enzyme:substrate(w:w) ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins were digested with Trypsin (Promega, UK) overnight at 37 °C at an enzyme to protein ratio of 1:20 ...
-
bioRxiv - Plant Biology 2023Quote: ... and tryptic digestion of proteins (V5111; Promega, Madison ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were pre-digested with LysC (Promega) for 2 h at 25 °C and digested with trypsin (Promega ...
-
bioRxiv - Plant Biology 2024Quote: ... or the MagneHis Protein Purification System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Subsequently proteins were digested with trypsin (Promega) at 37°C for 4 h ...
-
bioRxiv - Biochemistry 2023Quote: ... and the proteins were tryptic digested (Promega) at 37°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were digested with trypsin gold (Promega) at 1:50 enzyme to protein ratio in 50 mM TEAB ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Required fragments were PCR-amplified from wild-type genomic DNA and used as template for preparation of DIG-labeled probe using T7 RNA Polymerase (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant sodium channel expressing cell lines were generated by the transfection of wild type and F1579A mutant NaV1.4 BAC DNA constructs into HEK 293 cells (ATCC CRL-1573) by Fugene HD (Promega, Fitchburg, WI) transfection reagent according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Plant Biology 2022Quote: ... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: The interactions between host protein and RHDV nonstructural proteins were evaluated using a CheckMate Mammalian Two-Hybrid System (Promega). The proteins expressed from the pACT vector recombinant plasmid acted as prey proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Pull down of Halo-PfSR1 interacting proteins was performed using the HaloTag® Protein Purification System (Promega, cat # G1913) according to the manufacturer guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... the Halo-BysR protein was expressed using the TNT SP6 Wheat Germ Protein Expression System (Promega, Fitchburg, WI, USA). The Halo Tag-BysR protein was purified using magnetic HaloTag beads (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... the PhDEF and PhGLO1 proteins were produced with the TnT SP6 High-Yield Wheat Germ Protein Expression System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Protein was precipitated by the addition of 200 μl Protein Precipitation Solution (Promega Wizard HMW DNA Extraction Kit A2920). Using a wide bore tip the samples were mixed by drawing up contents from the bottom of the tube and then expelled on the side of the tube 5 times ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were expressed using TNT® SP6 High-Yield Wheat Germ Protein Expression System (Promega, Madison, Wisconsin, United States) with 2 µg Plasmid DNA as input ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of tRNAPhe(GAA) was performed using a 5’ biotinylated complementary oligonucleotide (5’-biotin-TGGTGCCGAAACCCGGGATTGAACCGGGG-3’) coupled to Streptavidin Magnesphere Paramagnetic particles (Promega). Annealing of specific tRNA was performed in 1 x TMA buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Cell Biology 2020Quote: Genomic GNA (gDNA) was extracted from each of the GFP+ and GFP-cell types using the Wizard Genomic DNA Purification Kit (Promega, Southampton, UK) and quantified using a Nanodrop 1000 Spectrophotometer (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... the luciferase activity for wild type and mutant pseudoviruses were determined using Steady-Glo luciferase assay system (Promega Corp; Madison; WI, USA), and luminescence assessed with a Glomax Multi Detection System (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... The wild-type and mut-circ_0002538 fragments were cloned downstream of the luciferase reporter gene of the pMIR-Report vector (Promega, Madison, WI, USA), while wild-type and mut-PLLP 3c-UTRs were inserted downstream of the hRluc (Renilla ...
-
bioRxiv - Molecular Biology 2021Quote: ... RPGR wild-type minigene construct was generated (Figure 2A) by amplification from a pool of human female genomic DNAs (Promega, Milan, Italy) using the following primers:
-
bioRxiv - Biochemistry 2023Quote: ... Enzymatic activities of KARS wild-type and mutants were determined by measuring AMP production and ATP consumption with AMP-Glo Assay Kit (Cat#V5011, Promega, Madison, USA) and ATP Bioluminescent Assay Kit (Cat#FLAA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 5 μL RNase inhibitor (Promega # N2615), 100 μL 5X reaction buffer (750 mM NaCl ...
-
bioRxiv - Neuroscience 2019Quote: ... Then 5 μL of MTase reagent B (Promega) were added to all of the wells ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...