Labshake search
Citations for Promega :
501 - 550 of 778 citations for Adenovirus Type 3 Particles Wild type since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 μg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... the final selection was performed by 3% agarose electrophoresis (80 V, 2 h, 1 kB Promega ladder). The selected clones were preincubated in growth medium (15 ml ...
-
bioRxiv - Immunology 2023Quote: Proteasome activity was measured in cell lysates using the Proteasome-Glo™ 3 Substrate System (Promega, G8531). Corresponding reagents for testing as chymotrypsin-like ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were first transfected with 3′UTR luciferase constructs (10 ng) using FuGENE HD transfection reagent (Promega) for 4 hours then transfected with Dharmacon miR-199a-5p mimic (50 nM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Immunology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately O/N using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2019Quote: ... 200 µg lysate was mixed with 0.1 µl RNase A (~3 mg/ml) and increasing concentrations of RNasin (Promega), as indicated ...
-
bioRxiv - Pathology 2021Quote: ... Cytopathic effects of the virus were measured after 3 days using the CellTiter-Glo luminescent cell viability assay (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... The sample was first treated by 2.5 μg of LysC (Wako) for 3 h at 37 °C with shaking and then treated with 2.5 μg of Trypsin (Promega) for over-night at 37 °C with shaking ...
-
bioRxiv - Bioengineering 2021Quote: ... on a 3.5 cm glass-based dish were transfected with 1.0 μg of EBFP (plasmid DNA) using 3 μL of FuGENE HD Transfection Reagent (Promega) in 10 μL of Opti-MEM (Life Technologies Corporation) ...