Labshake search
Citations for Promega :
201 - 250 of 4220 citations for 8 HYDROXY 1 3 DIOXOLO 4 5 G QUINOLINE 7 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 30° C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 37° C 60 min ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted 3 fold with 20mM HEPES pH 8.0 and digested in 10 @g ml-1 trypsin-TPCK (Promega) overnight at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Caspase activity was determined using Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI) according to the manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Promega Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI, Cat No. G8091) was used to quantify apoptotic cell death
-
bioRxiv - Microbiology 2021Quote: ... caspase activity was measured using Caspase-Glo 3/7 Assay according to manufacturer’s instructions (Promega). Staurosporine (1μM ...
-
bioRxiv - Neuroscience 2020Quote: Caspase activity was measured using a chemiluminescent assay kit (Promega Caspase-Glo® 3/7) in 96-well format using an Analyst HT plate reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 24 hr before adding 40 μl of Caspase-Glo 3/7 (Promega) to each well ...
-
bioRxiv - Cancer Biology 2021Quote: ... The remaining cells in the inserts were analyzed with Caspase-Glo 3/7 assay (Promega) to confirm that Jurkat cells incubated with TAM CM did not induce apoptosis compared to the control medium.
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activation was measured using the CaspaseGlo 3/7 Assay Kit (Promega, Madison, WI, USA) according to manufacturer’s instructions for the indicated time point presented in the figure legend ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was assessed by commercially available caspase 3/7 assay (Cat # G8090, Promega, Madison, WI) as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Molecular Biology 2020Quote: Apoptosis assays were performed using Caspase-Glo 3/7 reagent according to manufacturer’s instructions (Promega #0000239042). Cell viability assays were performed using WST-1 cell viability reagent according to manufacturer’s instructions (Sigma #18993700) ...
-
bioRxiv - Cell Biology 2021Quote: ... Caspase activation was measured using the Caspase Glo 3/7 Assay Kit (Promega, Madison, WI, USA) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... cell metabolic activity or caspase 3/7 activity was measured using the CellTiter-Glo assay (Promega) and Caspase-Glo 3/7 assay (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... apoptosis was quantified using the Apo-ONE homogeneous caspase-3/7 assay kit (Promega, Madison, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Caspase activity was determined using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: Caspase 3/7 activity was measured using the Caspase-Glo assay kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Caspase 3/7 activity and cell viability were determined by ApoTox-Glo assay kit (G6321, Promega). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase-3 and −7 activity was measured following three days of treatment (Caspase-Glo #G8093, Promega), while cell viability was obtained after six days of treatment (CellTiter-Glo 3D #G9681) ...
-
bioRxiv - Neuroscience 2024Quote: ... Caspase activity was measured with the Caspase-Glo® 3/7 (Promega Corp., Fitchburg, WI, USA) assay kit ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 3’UTR-: 5’-TTGCGGCCAGCGGCCGCTCTCCAAACTTGAATCAATAAATTT-3’ and inserted into a dual luciferase psiCHECK2 backbone (Promega). RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell numbers were quantified using a colorimetric 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... washed again in DPBS and stained with 1mg/ml X-gal (5-bromo-4-chloro-3-indolyl-β-galactopyranoside, Promega, Madison, WI, US) in DMF (Dimetil formamide ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay (Celltiter 96 Aqueous One-solution Cell Proliferation Assay, Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was revealed with a solution of NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate) (Promega, Madison, WI, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... 1 g of firefly luciferin (Promega) was dissolved in 66.6 mL of sterile PBS to create a 15 mg/mL solution ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Microbiology 2021Quote: ... containing 1 mM ethylenediaminetetraacetic acid (EDTA, Promega). The culture was then induced with 2 mM ZnCl2 and a 1 mL-sample was collected at 5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Total cell and mitochondrial free cholesterol and cholesterol ester contents were measured using the Cholesterol/Cholesterol Ester-Glo Assay Kit (J3190, Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: ... cells were subjected to Caspase 3/7 activity measurement with Caspase-Glo assay kit (Promega, Madison USA). Briefly ...