Labshake search
Citations for Promega :
51 - 100 of 2428 citations for 8 BROMO 2 3 4 5 TETRAHYDRO 1H PYRIDO 4 3 B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Bioengineering 2023Quote: ... the Caspase-Glo 3/7® or Caspase-Glo 8® assay (Promega) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Backbone and inserts were ligated either for 3 h at RT or overnight at 4°C using T4 ligase (Promega). All vector sequences (Table S5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Bone Morphogenetic Protein 4 (BMP4, 10 ng/ml, Bio-Techne) plus phosphoinositide 3-kinase inhibitor Ly294002 (10 µM, Promega). After 42 h incubation at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were seeded on 24 mm glass coverslips and transfected with 2 µg plasmid DNA (1:1.3:3 ratio LAMP1:ER:opto-kinesin) and Fugene6 transfection reagent (Promega 1:3) for 20-30 h prior to imaging ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 18 RNA extractions (3 morphs × 3 tissues × 2 biological replicates) were performed using the SV Total RNA Isolation System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µl of RNAse A solution (4 mg ml-1) (Promega) were added before incubation at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Bioengineering 2023Quote: ... 5 µL reactions were made by adding 4 µL LgBiT (Promega, N1120), 0.5 µL 100 µM p86-R4 (Vivitide ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Microbiology 2021Quote: ... or 3) Pepsin (Promega). 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL RNasin (Promega) and 100 µL lysis buffer for a total volume of 300 µL for IP by rotation for 2 hours at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Biochemistry 2021Quote: ... treated with 3 mM dithiothreitol (DTT) (molecular grade, Cat. 3483-12-3, Promega), and incubated for 30 min at 37°C in 5% CO2 in serum-free RPMI media ...
-
bioRxiv - Cancer Biology 2019Quote: ... which utilizes 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) (Promega, Madison WI). The assay was carried out according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: The 3’ UTRs were cloned into psiCheck-2 plasmid (Promega, USA, Cat. No. C8021) using the XhoI and NotI sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5–10 embryos were collected at 3 hpf and lysed in Passive Lysis Buffer (Promega) containing cOmplete Protease Inhibitor Cocktail (Sigma‒Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µl of 5x SSIV buffer and 2 µl of DNase (RQ1, Promega) was added ...