Labshake search
Citations for Promega :
251 - 300 of 3561 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 1 µl DTT (Promega), in 20 µl Superscript II buffer (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg trypsin (Promega) was added to the S-trap for 90 minutes at 47 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... or (1:25,000) (ProMega) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 % RNasin (Promega), and incubated for 15 min at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Luciferase (1:2500, Promega), Myc tag (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 mM luciferin (Promega), 14.5 mM NaHCO3 (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1Uμl-1 RNasein (Promega), 0.1% IGEPAL (Sigma)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5ml 1% digitonin (Promega), 0.5ml 10% Tween-20 (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 x buffer (Promega), 2.5 mM MgCl2 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:10000 (Promega: W4021) and in 3.5% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... psPAX2 and pMD2.G at the ratio of 1:1:1 in HEK293T cells using ProFection Mammalian Transfection System (Promega, E1200), medium was changed 16h post transfection and virus containing supernatant was harvested 48h later ...
-
bioRxiv - Biochemistry 2020Quote: ... three washes of 10 min in PBS-T were performed and membranes were incubated 1 hour at RT with the following 1:5000 or 1:2500 horseradish peroxidase conjugated secondary antibodies in 1% milk in PBS-T: anti-mouse (Promega, #W402B), anti-rabbit (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1:2000 RealTime-Glo MT Cell Viability Assay Substrate (to visualise Nluc, first diluted 1:1 in DMSO, Promega G9711).
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... CellTiter 96 AQueous One Non-Radiactive Cell Proliferation Assay based on 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) was from Promega (Duebendorf, Switzerland). COmplete™ EDTA-free protease inhibitor cocktail was obtained from Roche Diagnostics (Mannheim ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 4 h later 5 µl/well of NanoBRET™ Nano-GloR Substrate (10 µl/ml in DMEM no phenol red, Promega) was added and 460 nm donor and 618 nm acceptor signals were read within 10 min of substrate addition using CLARIOstar microplate reader (Mandel) ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 μl of Trypsin/LysC solution [100 ng/μl 1:1 Trypsin (Promega) and LysC (FujiFilm ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then 1 µl (1-3 units) of T4 ligase (Promega, Madison, US) was added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 75 μL (1:1 volume) of One-Glo™ reagent (E6110, Promega) was added to each well ...
-
bioRxiv - Neuroscience 2021Quote: ... IΒΑ1 (1:250, rabbit, Wako, 01919741) and p75NTR (1:1000, rabbit, G3231, Promega). Sections were washed 3×20 min in PBS prior to incubation with secondary antibodies (Alexa Fluor ...
-
bioRxiv - Biochemistry 2022Quote: ... 6 μl of Trypsin/LysC solution (100 ng/μl 1:1 Trypsin (Promega) and LysC (FujiFilm) ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were collected and mixed 1:1 with BrightGlo Luciferase assay reagent (Promega) and luminescence was measured using a luminometer (Molecular Devices ...
-
bioRxiv - Molecular Biology 2022Quote: ... alongside a 1:1 molar ratio of Luciferase (pGL4.23) to Renilla (pGL4.75, Promega) vectors ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM DTT) or with 1 unit of RQ1 DNase (Promega; RNase-free) in 40 μL of RQ1 buffer (40 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then diluted 1:1 with Milli-Q water and trypsin (Promega) added at the same enzyme/protein ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... psPAX2 and pMD2.G at the ratio of 1:1:1 in HEK293T cells using ProFection® Mammalian Transfection System (Promega, E1200), medium was changed 16h post transfection and virus containing supernatant was harvested 48h later ...
-
bioRxiv - Biochemistry 2021Quote: ... the sample was diluted 1:1 with 50 mM ammonium bicarbonate and proteins were digested with trypsin (protein to enzyme ratio 1:50, Promega, Mannheim, Germany) overnight at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... The samples were diluted 1:1 with milliQ water and were incubated with a 1:100 w/w amount of trypsin (Promega, sequencing grade) overnight at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The protein solution was further diluted down to less than 2 M urea with 50 mM Tris-Cl (pH 8) and incubated with 2 μg of modified trypsin (w/w, 1∶50) (Promega, Madison, WI, USA) at 37°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of tRNAPhe(GAA) was performed using a 5’ biotinylated complementary oligonucleotide (5’-biotin-TGGTGCCGAAACCCGGGATTGAACCGGGG-3’) coupled to Streptavidin Magnesphere Paramagnetic particles (Promega). Annealing of specific tRNA was performed in 1 x TMA buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl, 1 mM MgCl2, 2 mM EDTA, 1% NP-40, 1 mM DTT, 100 U/mL RNasin [Promega], 1X protease inhibitor) at 7 dpi ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...