Labshake search
Citations for Promega :
251 - 300 of 1705 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of HiBiT lytic reagent (Promega N3040 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 5 μg/mL Trypsin (Promega:487603)) for 1 hour at 25°C on a shaker (1000 rpm) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Physiology 2024Quote: ... (Promega #E1941, diluted 1:5 with water). Dual-Glo Luciferase assays were performed to measure Firefly and Renilla luciferase activity (Promega #E2940) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl 5x optimized transcription buffer (Promega), 2 µl T7 RNA polymerase (20 U.ml-1 ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the tRNA pellet was resuspended in water and incubated with 8 U of RQ1 RNAse-free DNAse (Promega) at 37 °C for 30 min according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... HMW DNA was resuspended in 10 mM Tris pH 8 and quantified by Quantus™ Fluorometer (Promega Inc). The DNA size and integrity were assessed on TapeStation™ instrument (Agilent ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene of interest was amplified using designed primers (Supplementary Table 8) and cloned into pGEMT-Easy vector (Promega). Using the DIG RNA Labelling Kit (Roche Diagnostics) ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 8 µg of pcDNA3.1-GFP-mNLS-K145Q using Fugene 6 Transfection reagent (Promega, E2692) per manufacturer protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid; #V542A, Promega, WI, USA), and 39 μl or 49 μl 250 mM Tris buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Ethylenediaminetetra-acetic acid (EDTA, 0.5 M, pH 8.0) and trypsin were purchased from Promega (Madison, WI). Lysyl endopeptidase (Lys-C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequencing grade modified trypsin with acetic acid resuspension buffer was obtained from Promega (Madison, WI, USA). Paramagnetic beads for SP3 (Sera-Mag Speed Beads A and B ...
-
bioRxiv - Genetics 2019Quote: Nucleic acids were extracted from blood samples using the Wizard genomic DNA Promega Kit (Promega Corporation). Multiplex ...
-
bioRxiv - Biochemistry 2021Quote: ... precipitated by trichloroacetic acid precipitation and digested with 1:50 (w/w) chymotrypsin (Promega, Cat #V106A) in 100 mM Tris-HCl and 10 mM CaCl2 for 18 h at 37 °C with shaking ...
-
bioRxiv - Genomics 2021Quote: ... in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega) in a Maxwell® RSC instrument following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: The Maxwell® RSC Viral Total Nucleic Acid Purification Kit (cat. # ASB1330, Promega Corporation, Maddison, WI) was used to isolate RNA as instructed by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: The sequence encoding RARα LBD (amino acids 176-421) was cloned into pBIND vector (Promega E245A) to generate pBIND-RARα LBD ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was extracted from plasma using the Viral Total Nucleic Acid Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of tRNAPhe(GAA) was performed using a 5’ biotinylated complementary oligonucleotide (5’-biotin-TGGTGCCGAAACCCGGGATTGAACCGGGG-3’) coupled to Streptavidin Magnesphere Paramagnetic particles (Promega). Annealing of specific tRNA was performed in 1 x TMA buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...