Labshake search
Citations for Promega :
401 - 450 of 4464 citations for 7 nitro 3 oxido 6 4 phenylpiperazin 1 yl 2 1 3 benzoxadiazol 3 ium since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Biochemistry 2021Quote: ... free thiols were alkylated by iodoacetamide and proteins were sequentially digested with endoproteinase Lys-C (Wako, 1:100 enzyme-to-substrate ratio, 3 h at 37 °C) and trypsin (Promega, 1:50, overnight at 37 °C). Digested samples were desalted ...
-
bioRxiv - Microbiology 2019Quote: ... Chimeric pREC NFL INT plasmids were co-transfected into HEK293T cells (3 × 104 cells/well) along with the complementing plasmid pCMV cplt using Fugene 6 reagent (Promega, Madison, WI) as described previously [44] ...
-
bioRxiv - Bioengineering 2022Quote: ... The DNA transfection reagents were prepared by incubating 3 µg of plasmid DNA encoding the Bxb1 recombinase and 6 µL of Fugene6 reagent (Promega Cat # E2693) in 300 µL of Opti-MEM for 15 minutes and then added to the cell suspension ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Backbone and inserts were ligated either for 3 h at RT or overnight at 4°C using T4 ligase (Promega). All vector sequences (Table S5 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Bone Morphogenetic Protein 4 (BMP4, 10 ng/ml, Bio-Techne) plus phosphoinositide 3-kinase inhibitor Ly294002 (10 µM, Promega). After 42 h incubation at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Microbiology 2019Quote: ... The next day they were transfected over 24 hours with a DNA-Fugene HD mixture at a ratio of 1 μg DNA to 3 μl Fugene (Promega, Southampton, UK) according to the manufacturer’s instructions (Western analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... were inserted using XhoI and NotI sites in 3’ UTR of Renilla gene in the psiCheck-2 dual luciferase reporter vector (Promega). The reporter in the amount of 25 ng and plasmids with different NORAD variants in the amount of 200 ng were introduced per 30,000 cells in 24-well plates ...
-
bioRxiv - Synthetic Biology 2019Quote: The wild type and mutant 3’ UTR of BRCA1 were constructed into psi-check-2 vector (Promega, Madison, WI, USA). Cells were plated in 24-well plates and the plasmids (psi-check-2-WT ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was co-transfected with 3 ng phRG-TK Renilla vector (Promega) as normalization control ...
-
bioRxiv - Cancer Biology 2019Quote: ... After 3 days cell viability was measured using CellTiter-Glo reagent (Promega). All experiments were measured as technical triplicates and the experiments were repeated at least twice each.
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 ng of the Renilla Luciferase expressing pRL-SV40 plasmid (Promega) for normalization ...
-
bioRxiv - Cell Biology 2021Quote: ... 3) TGFβ2 (2.5 ng/ml) + U0126 (10 μM; Promega, Madison, WI, USA), 4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... amplicons were ligated into the Renilla luciferase 3’UTR of psiCheck2 (Promega) vector linearized with Xho-I and Not-I ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... by addition of 3 μl Renilla-Glo™ reagent (Promega, Cat# E2710) and measuring the luminescence signal with the ViewLux uHTS Microplate Imager (PerkinElmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... plate lids were removed and 3 μL of CellTiter-Glo One (Promega) were added to each well by using a solenoid valve dispenser ...