Labshake search
Citations for Promega :
251 - 300 of 403 citations for 7 cyclopropyl 7 oxoheptanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... membrane integrity (CytoTox-OneTM homogeneous membrane integrity assay kit: lactate dehydrogenase (LDH release) and caspase activity/ apoptosis (Caspase-Glo® 3/7 assay system kit) (all from Promega, WI, USA), as described previously17 (see Supplementary data for detailed description).
-
bioRxiv - Bioengineering 2024Quote: ... 100 uL of the diluted lysate was added to each well along with an equal volume of Caspase Glo 3/7 assay reagent (Promega, Madison, Wisconsin, USA), according to the manufacturer’s directions ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...
-
bioRxiv - Genetics 2023Quote: ... 1x or 2x TAE (Tris base, acetic acid, ethylenediaminetetraacetic acid; Promega) buffered agarose gel electrophoresis was used to separate DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10μM amino acids (Promega), 0.21mM spermidine ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.4 mM amino acid mixture (Promega) and 1 u/µl NxGen RNase inhibitor (Lucigen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 67 µM amino acid mixture (Promega), 1x cOmplete protease inhibitors EDTA-free ...
-
bioRxiv - Biophysics 2019Quote: ... 10 µM amino acids mixture (Promega), 1 U/µL murine RNase inhibitor (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid mix lacking Met (Promega) and 0.1 × volume of an in vitro transcribed mRNA (200-1,000 ng/μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 mM amino acid mixture (Promega) and 1 u/µl NxGen RNase inhibitor (Lucigen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 20 μM amino acid mix (Promega), and 2mM DL-dithiothreitol ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 μM amino acid mixture (Promega), 50 μM Spermidine ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μM amino acids mixture (Promega), 1 u/μl RiboLock RNase inhibitor (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 μM amino acids (Promega PRL4461), 255 μM spermidine ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Maxwell nucleic-acid extraction instrument (Promega). Nanodrop quantified RNA was checked by Bioanalyzer RNA 6000 Nano Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2019Quote: ... 30 µM of amino-acid mixture (Promega) and 0.35 U/µl of RNAse inhibitor (SUPERase ...
-
bioRxiv - Biochemistry 2021Quote: ... 25 μM amino acids minus methionine (Promega), 1 μM Ipom-F ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.02 mM of each amino acid (Promega), 33% RRL (Promega ...
-
bioRxiv - Biophysics 2020Quote: ... 10 μM amino acids mixture (Promega, L4461), 1 U μL−1 murine RNase inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 µM amino acid mix (complete, Promega), 4 U RNaseIn plus Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 1 mM ethylenediaminetetraacetic acid (EDTA, Promega). The culture was then induced with 2 mM ZnCl2 and a 1 mL-sample was collected at 5 ...
-
bioRxiv - Microbiology 2022Quote: ... 25 μM amino acids minus methionine (Promega), 6.5% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... The Diamond™ Nucleic Acid Dye (Promega) staining was used to visualize DNA on the gel ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.24 mM amino acid mix – met (Promega L9961), 10.2 mM DTT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.05 mM each of 20 amino acids (Promega), 0.5 mM spermidine ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.05 mM each of 20 amino acids (Promega), 0.5 mM spermidine ...
-
bioRxiv - Microbiology 2023Quote: ... 6 μL S30 premix without amino acids (Promega), plus water to a final reaction volume of 15 μL were incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.6 μl complete amino acid mixture (Promega, L4461), 0.4 μl Ribolock nuclease inhibitor (ThermoFisher Scientific ...