Labshake search
Citations for Promega :
251 - 300 of 4940 citations for 7 chloro 3' 4 6 trimethoxy 5' methylspiro 1 benzofuran 2 6' cyclohex 2 ene 1' 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cell Biology 2022Quote: FuGENE 6 (Promega) was used to transfect RPE1 cells with plasmids for generating CRISPR/Cas9 knockouts ...
-
bioRxiv - Cell Biology 2021Quote: ... FuGENE 6 (Promega) transfection reagent was used according to the manufacturer’s instructions to transfect HeLa cells at a 3:1 ratio (using 1.5 μL FuGENE 6 and 0.5 μg DNA per well) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fugene 6 (Promega) was used to transfect 5 μg of vector into 100 mm plates of COS-7 cells ...
-
bioRxiv - Systems Biology 2021Quote: ... Fugene 6 (Promega) was used for transfection one day before imaging following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... FuGENE 6 (Promega) transfection reagent was used according to the manufacturer’s instructions to transfect at a 3:1 ratio (using 1.5 µL FuGENE 6 and 0.5 µg DNA per well) ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGENE 6 (Promega) was used for all transfections according to the supplied protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Fugene 6 (Promega) or Fugene 4K (Promega ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was analyzed using Caspase-Glo 3/7 Assay (Promega, Madison, WI), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Neuroscience 2019Quote: ... caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega). Cell viability was detected using the CytoPainter Live Cell Labeling Kit (Abcam ...
-
bioRxiv - Biochemistry 2020Quote: ... the Caspase-Glo 3/7 reagent (G8092/G8093 kit; Promega, Madison WI, USA) was prepared at room-temperature according to the manufacturer′s specifications ...
-
bioRxiv - Biochemistry 2022Quote: ... Apoptosis was measured using the Caspase-Glo® 3/7 assay system (Promega). Cells were seeded at a density of 1 × 104 in 96-well black polystyrene microplates (Corning) ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was measured with the caspase-Glo 3/7 assay (Promega Cat# G8092), following manufacturer recommendations.
-
bioRxiv - Molecular Biology 2022Quote: Active caspases were detected using the Caspase-Glo 3/7 Assay System (Promega). The experiment was set up using the same protocol as proliferation assay ...
-
bioRxiv - Bioengineering 2023Quote: ... the Caspase-Glo 3/7® or Caspase-Glo 8® assay (Promega) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Flo (Promega) or CaspaseGlo (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Glo (Promega) or Caspase Glo (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Caspase Glo® 3/7 Assay (Promega Corporation, Madison, WI, USA) following the manufacturer’s protocol and plates were read on an EnVision Multilabel Plate Reader (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and apoptosis was determined using the Caspase 3/7 Glo Assay (G8090, Promega) measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: Apo-ONE® Homogeneous Caspase-3/7 Assay (Promega Corporation, Madison, WI, USA) was used to determine the caspase activity in the extracted tumors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Figure 6 and Figure 7) to form condensates in cells was monitored by transient transfection of U-2 OS cells using FuGene (Promega; Figures 2 and 7) or electroporation (as before ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μg of RNA was treated with DNase 1 (Promega) for 2 hours at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... in a 3:1 ratio of FuGENE®HD (Promega) transfection reagent to DNA ...
-
bioRxiv - Microbiology 2019Quote: ... Chimeric pREC NFL INT plasmids were co-transfected into HEK293T cells (3 × 104 cells/well) along with the complementing plasmid pCMV cplt using Fugene 6 reagent (Promega, Madison, WI) as described previously [44] ...
-
bioRxiv - Bioengineering 2022Quote: ... The DNA transfection reagents were prepared by incubating 3 µg of plasmid DNA encoding the Bxb1 recombinase and 6 µL of Fugene6 reagent (Promega Cat # E2693) in 300 µL of Opti-MEM for 15 minutes and then added to the cell suspension ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild type or mutant 3′-UTR of DKK3 was cloned into the psicheck-2 vector (Promega). HCT116 cells were transfected with and wild-type or mutant 3′-UTR-luc by using Lipofectamine 3000 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2-3 μg of the purified RNA was in vitro translated using wheat germ extract (Promega) at 25 °C for 2 h as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Cytotoxicity was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) assay kit (Promega) by determining Formazan absorbance at 590 nm on a Tecan Safire automated plate reader ...
-
bioRxiv - Immunology 2023Quote: ... COS-1 cells were transfected with pBRmac239 proviral DNA using FuGENE 6 (Promega). At 48 h post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 μL of CellTiter-Glo reagent solution (Promega, diluted 1:6 in water) was added to each well after 24 h and 72 h of compound treatment ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 spike protein (23) into HEK 293T cells using the FuGENE 6 Transfection Reagent (Promega). Spike sequences from the following global strains REF were used ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 2 μg of FLAG-tagged β2 or β1 adrenergic receptor DNA using Fugene 6 (Promega) and seeded at a density of ∼70,000 cells.ml−1 on 18 mm glass coverslips 4-8 hours after transfection.
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 2 μg of fresh bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311) according to the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Microbiology 2020Quote: ... or Vpr F34I/P35N mutant using 6 μl Fugene-6 (Promega). For KPNA-cargo IPs HEK293T cells were grown in 10 cm dishes and co-transfected with 1 μg of a plasmid expressing FLAG-tagged KPNA1 ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2020Quote: ... Caspase 3/7 activity was measured using an Apolive-Glo kit (Promega, Madison, WI) and measured using a SpectraMax M5 (Molecular Devices ...
-
bioRxiv - Physiology 2020Quote: ... caspase 3/7 activity was measured using ApoLive-Glo Multiplex Assay (Promega, Madison, WI). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell apoptosis was assessed using either the CaspaseGlo 3/7 assay (G8090, Promega, UK) according to the manufacturer’s instructions (N=4 replicates) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Effector caspase activity was assessed using the Caspase-Glo 3/7 Assay System (Promega) following a previous protocol (Ronai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal volume of Caspase-Glo® 3/7 Assay System (Cat. No.G8090, Promega) was transferred into each well and incubated for 1 h and measured by a GloMax® 20/20 Luminometer ...