Labshake search
Citations for Promega :
651 - 700 of 887 citations for 7 Fluoro 1H indazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were diluted with 20 mM HEPES pH 8.0 to a urea concentration of 2 M and the proteins were digested with 4 µl Trypsin/LysC (Promega V5073: 20ug + 80uL 50mM acetic acid) for 4 hours at 37°C and boosted with an extra 2µl Trypsin/LysC (Promega V5073 ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA was extracted from the OP and CL swab samples collected from chickens and tufted ducks using Maxwell® 16 Viral Total Nucleic Acid Purification Kit on a Maxwell® 16 System extraction robot (Promega, Madison, WI, USA). RNA was isolated from lung ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Immunology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately O/N using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2019Quote: ... 200 µg lysate was mixed with 0.1 µl RNase A (~3 mg/ml) and increasing concentrations of RNasin (Promega), as indicated ...
-
bioRxiv - Pathology 2021Quote: ... Cytopathic effects of the virus were measured after 3 days using the CellTiter-Glo luminescent cell viability assay (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... The sample was first treated by 2.5 μg of LysC (Wako) for 3 h at 37 °C with shaking and then treated with 2.5 μg of Trypsin (Promega) for over-night at 37 °C with shaking ...
-
bioRxiv - Bioengineering 2021Quote: ... on a 3.5 cm glass-based dish were transfected with 1.0 μg of EBFP (plasmid DNA) using 3 μL of FuGENE HD Transfection Reagent (Promega) in 10 μL of Opti-MEM (Life Technologies Corporation) ...
-
bioRxiv - Microbiology 2021Quote: ... and NS1 (3′) sequences were determined from purified product cloned into the pGEM-T vector by TA-cloning (Promega) according to the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately overnight using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Cell Biology 2021Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Biophysics 2022Quote: ... DTT was added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37 °C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were diluted 10-fold with 25 mM ammonium bicarbonate and digested with 3 µg of trypsin (Promega, v5111) overnight at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were seeded onto acid-washed coverslips at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1μg of plasmid DNA using 3 μl Fugene HD transfection reagent (Promega). HaloTagged AP-2 σ2 was visualized by adding Janelia Fluor 646-HaloTag ligand (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat. #E1531) prior to firefly and Renilla luciferase activity measurements which were performed in triplicate using the Dual-GLO kit (Promega cat ...
-
bioRxiv - Microbiology 2023Quote: ... Imaging was performed 3 min after intraperitoneal (i.p.) injection of 150 mg/kg D-Luciferin (Beetle Luciferin Potassium Salt, Promega) in the IVIS® Spectrum In Vivo Imaging System under 2.5% isoflurane inhalation anesthesia using 15 min exposure ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted 3 fold with 20mM HEPES pH 8.0 and digested in 10 @g ml-1 trypsin-TPCK (Promega) overnight at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of lenti-viral transfer plasmids previously described along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Probe synthesis reactions were performed at 37 °C for 3 h and then were treated with DNase I (Promega) at 37 °C for 20 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CP4 medium was exchanged with Hanks’Balanced Salt Solution (with added glucose 1 g/l, NaHCO3 0.35 g/l) containing GloSensor cAMP Reagent (3 %, Promega) and plates were incubated for 60 min ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then transfected with plasmid DNA (4µg per plasmid per flask) using FuGENE HD (1:3 ratio; Promega) and cultured at 28°C.
-
bioRxiv - Molecular Biology 2024Quote: ... RT-PCR was used to amplify the OGDH 3’UTR and sub clone it into pmirGLO vector (Promega, UK). 5 × 10^4 C2C12 cells were seeded into 12 well plates ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mtfp1 and Gnpat 3’UTRs and Tnksbp1 and Gnpat CDS were amplified by PCR from MIN6 cDNA and subcloned into pmirGLO (Promega), downstream the Firefly ORF ...
-
bioRxiv - Molecular Biology 2021Quote: ... were inserted using XhoI and NotI sites in 3’ UTR of Renilla gene in the psiCheck-2 dual luciferase reporter vector (Promega). The reporter in the amount of 25 ng and plasmids with different NORAD variants in the amount of 200 ng were introduced per 30,000 cells in 24-well plates ...
-
bioRxiv - Developmental Biology 2020Quote: ... and ‘TA cloned’ (after addition of 3’ adenine nucleotide overhangs) it into pGEM®-T-Easy plasmid vector (Promega, A1360). The derived plasmid was mutagenised (commercial service ...
-
bioRxiv - Biochemistry 2022Quote: HeLa and HEK293T cells were seeded on 18 mm glass coverslips at a density of 3×105 cells/mL and were transfected with FuGENE 6 (Promega) transfection reagent 24 h later ...