Labshake search
Citations for Promega :
351 - 400 of 753 citations for 7 Diethylamino 3 thenoyl coumarin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... followed by 3 h at 37°C using trypsin (Promega). All proteolytic digests were acidified to pH 2 by addition of 10% formic acid and directly analyzed by LC-ESI-MS/MS ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Microbiology 2023Quote: ... the permeabilization protocol used a 3 minute 0,02% digitonin (Promega) exposure ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Molecular Biology 2019Quote: A 3:1 ratio of FuGENE® HD Transfection Reagent (Promega) (μL ...
-
bioRxiv - Immunology 2021Quote: ... then each well was diluted 1:3 with TE buffer (Promega). A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Biochemistry 2024Quote: ... using random primers and oligo-dT primers (3:1 mol) (Promega). The obtained cDNA was stored at −20 °C until further use.
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was co-transfected with 3 ng phRG-TK Renilla vector (Promega) as normalization control ...
-
bioRxiv - Molecular Biology 2021Quote: ... transfected with 1 µg DNA and 3 µl FuGENE HD (Promega, E2311) in 150 µl Opti-MEM media according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... After 3 days cell viability was measured using CellTiter-Glo reagent (Promega). All experiments were measured as technical triplicates and the experiments were repeated at least twice each.
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Microbiology 2021Quote: ... and pVSV-G (4:3:1 ratio) using calcium phosphate transfection (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 ng of the Renilla Luciferase expressing pRL-SV40 plasmid (Promega) for normalization ...
-
bioRxiv - Cell Biology 2021Quote: ... 3) TGFβ2 (2.5 ng/ml) + U0126 (10 μM; Promega, Madison, WI, USA), 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-activated Caspase 3 (rabbit, Promega, catalog #G7481, 1:250, RRID:AB_430875), and appropriate secondary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... amplicons were ligated into the Renilla luciferase 3’UTR of psiCheck2 (Promega) vector linearized with Xho-I and Not-I ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by 3 μL sequencing-grade trypsin solution (1 μg/μL, Promega), and the sample was incubated for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... by addition of 3 μl Renilla-Glo™ reagent (Promega, Cat# E2710) and measuring the luminescence signal with the ViewLux uHTS Microplate Imager (PerkinElmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... plate lids were removed and 3 μL of CellTiter-Glo One (Promega) were added to each well by using a solenoid valve dispenser ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 μL of BrightGlo reagent solution (Promega, diluted 1:3 in water) was added to each well after 24 h of compound treatment ...
-
bioRxiv - Immunology 2023Quote: ... and were lysed 3 days post-infection using 1x lysis buffer (Promega) for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 μL of 1:100 diluted NanoBRET Nano-Glo substrate (Promega N1571) was added ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...