Labshake search
Citations for Promega :
251 - 285 of 285 citations for 7 Chloro 1H indene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The sample was diluted 1:7 with 0.1 M NH4HCO3 before overnight digestion of proteins with trypsin (Promega, cat#V5113) at 30°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... the MCF-7 and MDA-MB-231 cells were infected with Plasmids expressing RFP or GFP using Fugene 6 (Promega) at an early passage and were selected using 2 μg/ml puromycin (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell number was measured after 3 and 7 days and normalized to the initial reading at day 0 using the CellTiter Glo Luminescent Cell Viability Assay (Promega). The experiments shown represent fold change at day 7 relative to day 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MCF-7/CA-IX cell lines by standard clonogenic stable cell construction procedures using Fugene HD (Promega, E 2311). The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001 ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... membrane integrity (CytoTox-OneTM homogeneous membrane integrity assay kit: lactate dehydrogenase (LDH release) and caspase activity/ apoptosis (Caspase-Glo® 3/7 assay system kit) (all from Promega, WI, USA), as described previously17 (see Supplementary data for detailed description).
-
bioRxiv - Bioengineering 2024Quote: ... 100 uL of the diluted lysate was added to each well along with an equal volume of Caspase Glo 3/7 assay reagent (Promega, Madison, Wisconsin, USA), according to the manufacturer’s directions ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...