Labshake search
Citations for Promega :
351 - 400 of 4596 citations for 7 CHLORO N N DIETHYL 4 NITRO 2 1 3 BENZOXADIAZOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The amplified DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Cat. N° A9281 Promega), then the DNA was sequenced using the Macrogen facility (https://dna.macrogen.com/).
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Biochemistry 2024Quote: ... HEK293T cells were transfected with 3.5μg of N-terminally FLAG-tagged receptor and 3.5μg of an SRE-based luciferase reporter plasmid pGL4.33 (Promega, Cat. no: E1340). 14-16h after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were subjected to Caspase 3/7 activity measurement with Caspase-Glo assay kit (Promega, Madison USA). Briefly ...
-
bioRxiv - Immunology 2019Quote: Cell viability and caspase 3/7 activity were measured using Non-Radioactive Cell Proliferation Assay kit (Promega) and Caspase-Glo® 3/7 assay kit (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability and Caspase activity were detected with CellTiter-Glo 2.0 and CaspaseGlo-3/7 assay (Promega) respectively 2 days after transfection ...
-
bioRxiv - Genomics 2023Quote: ... the final selection was performed by 3% agarose electrophoresis (80 V, 2 h, 1 kB Promega ladder). The selected clones were preincubated in growth medium (15 ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... TC-32, POE) and three SOX6 moderately/lowly expressing EwS cells (A673, SK-N-MC, EW7) using GoTaq DNA Polymerase (Promega, Germany) and primer sequences listed in Supplementary Table 5 ...
-
bioRxiv - Biophysics 2019Quote: ... Amino-PEG-QDs (Thermo, Q21521MP) were labelled with HaloTag ligand by reaction with N-hydroxysulfosuccinimide reactive Halo-Tag ligand (Promega, P6751) or Snap-Tag ligand for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MSN(T558A) genes with either N-terminal or C-terminal SmBit and LgBiT fusions were produced using Flexi®-based cloning (Promega). Best luminescence signals were obtained with CD44 containing a C-terminal smBiT fusion (C-terminal smBiT ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids used as DNA template in PCR reactions to generate donor DNAs for gene deletion/disruption strategies were obtained by amplifying blasticidin S deaminase (BSD) and puromycin-N-acetyltransferase (PAC) genes and cloning them individually into pGEM®-T Easy Vector (Promega). The reverse primers to amplify both genes included GTGA as four last nucleotides ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then diluted 1:7 in Glo Lysis Buffer (Promega) and incubated 1:1 for 5 minutes in the dark in opaque 96 well plates with NanoGlo Substrate freshly diluted 1:50 in NanoGlo Buffer (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: To compare Promega’s NanoBiT system β-arrestin2 was inserted at the C-terminal end of LgBiT using Promegas pBiT1.1-N vector (Promega Cat. #N2014) and the doubly palmitolyated fragment of GAP43 was inserted at the N-terminal of SmBiT using the pBiT2.1-C vector.
-
bioRxiv - Microbiology 2020Quote: ... Proteins were digested O/N at 37°C with mass spectrometry grade lysyl endopeptidase LysC and sequencing grade modified trypsin (Promega LTD, UK).
-
bioRxiv - Genomics 2021Quote: ... were transfected at 20 μM in SK-N-SH cells at a density of 104 -105 cells using FuGene HD Transfection reagent (Promega Corporation, USA) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... were transfected at 25 µM concentration in SK-N-SH cells at a density of 104 -105 cells using FuGene HD Transfection reagent (Promega Corporation, USA), per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 1ug of total RNA extracted from transfected SK-N-MC cells was reverse transcribed using the ImProm-II Reverse Transcription System and random hexamer primers (Promega, Madison, MI). PowerUp SYBR™ Green Master Mix (Thermo Fisher ...
-
bioRxiv - Biophysics 2023Quote: ... Halo-EGFR constructs used for FRET-FLIM experiments were created using the HA-EGFR plasmid and the Gibson assembly approach to replace the N-terminal HA tag with the HaloTag® plasmid (Promega, #G7711). The final resulting construct contained the HaloTag and a GSGS linker region after the EGFR signal sequence ...
-
bioRxiv - Cancer Biology 2023Quote: ... day 5 and day 7 for each condition using the CellTiter-Glo (CTG) luminescence-based assay (Promega). Diluted CTG reagent (100 uL 1:4 CTG reagent to PBS ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL of cells were mixed with 20 μL of the CellTiter-Glo 2.0 Cell Viability Reagent or Caspase-Glo 3/7 Assay substrate (Promega). Luminescence was measured after 2 min incubation for CellTiter-Glo 2.0 or 30 min incubation for Caspase-Glo 3/7 Assay using the Synergy H1 microplate reader as above ...
-
bioRxiv - Cancer Biology 2023Quote: The 3-dimensional (3D) culture studies were performed using MCF-7 cells and low melting point agarose (Promega, Australia). Agarose was suspended in PBS at a concentration of 0.75% (w/v) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Genomics 2023Quote: ... at 0.5 uM or DMSO (vehicle) followed by measurement of Caspase activity via the Caspase-Glo 3/7 assay (Promega). Results are representative of at least 3 independent experiments ...
-
bioRxiv - Microbiology 2019Quote: ... For transfection 0.5 or 2 µg of plasmid DNA in 25 or 200 µL serum-free medium were mixed with 1 or 4 µL of FuGENE HD transfection reagent (DNA to reagent ratio of 1:2, Promega, Mannheim, Germany) and incubated for 10 min at RT ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... and incubated with a 20 µg/ml solution of the HaloTag amine (O4) ligand (Promega) overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids with the arsC-1Fas and arsC-2Fas correct sequences were purified by miniprep (Wizard® Plus SV Minipreps, Promega, cat. n° A1360) and double digested with XhoI and HindIII (Thermo Scientific™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... Larvae with the same genotype were pooled (min. n=10 larvae/sample) and RNA was extracted using the ReliaPrep RNA Miniprep System (Promega AG, Dübendorf, Switzerland) following manufacturer’s user guide ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Neuroscience 2020Quote: Caspase 3/7 activity in primary neuronal cells was measured using ApoTox-Glo Triplex Assay kit (Promega, Madison, WI, USA) as per the manufacture’s instruction ...
-
bioRxiv - Microbiology 2020Quote: Apoptosis induction by T3DC and inhibition by Z-VAD-FMK was determined using the Caspase-Glo 3/7 Assay System (Promega). PC3 cells were plated at 1 × 104 cells per 96 well plate and 24 h later were either treated with docetaxel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Cell Biology 2020Quote: Measurements of caspase activities in cells were performed using the commercially available Caspase-Glo 3/7 Assay (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...