Labshake search
Citations for Promega :
301 - 350 of 2899 citations for 7 Bromo 6 chloro 3 3 3 hydroxy 2 piperidyl 2 oxopropyl quinazolin 4 3H one monohydrobromide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Caspase 3/7 activity in primary neuronal cells was measured using ApoTox-Glo Triplex Assay kit (Promega, Madison, WI, USA) as per the manufacture’s instruction ...
-
bioRxiv - Microbiology 2020Quote: Apoptosis induction by T3DC and inhibition by Z-VAD-FMK was determined using the Caspase-Glo 3/7 Assay System (Promega). PC3 cells were plated at 1 × 104 cells per 96 well plate and 24 h later were either treated with docetaxel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Cell Biology 2020Quote: Measurements of caspase activities in cells were performed using the commercially available Caspase-Glo 3/7 Assay (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... organoids were embedded in 3% agarose (Promega, #V3125), sectioned at 120-µm thickness and collected in 30% sucrose in 1× PBS for cryopreservation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Synthetic Biology 2019Quote: ... ligated for 3 h at room temperature (RT) or overnight at 4°C using T4 ligase (Promega), and propagated in E.coli XL 10 Gold cells (Agilent) ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of lenti-viral transfer plasmids previously described along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were incubated in PBDS for 3 days at 4°C followed by 4 washes over the next 24 hours with 0.2% Tween-20 (Promega UK Ltd; H5151) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: HeLa and HEK293T cells were seeded on 18 mm glass coverslips at a density of 3×105 cells/mL and were transfected with FuGENE 6 (Promega) transfection reagent 24 h later ...
-
bioRxiv - Molecular Biology 2021Quote: RNA extraction from liver tissue (n=3-6 biological replicates per group) was performed using the ReliaPrep RNA Miniprep system (Promega), as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were seeded in 24-well tissue culture plates at a density of 1.6 x 105 cells/well and transfected with 50-100 ng/well of pNL4-3-GFP using Fugene HD (Promega) transfection reagent ...
-
bioRxiv - Biophysics 2020Quote: ... We stained the cells with 3-6 pM Halo-SiR ligand 48 directly before imaging according to the protocol of the manufacturer (Promega) to obtain equal molecular densities during imaging and therefore minimize differences in tracking losses.
-
bioRxiv - Bioengineering 2022Quote: ... To determine the optimum transfection ratio multiple complexes were created (1.5:1, 3:1, 6:1) using ViaFect Transfection reagent (Promega, E4981) and pGL4.51 [luc2/CMV/Neo] plasmid vector (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...