Labshake search
Citations for Promega :
251 - 300 of 4512 citations for 7 Bromo 5 methyl 1 2 4 benzotriazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... RAC2 3’UTR-: 5’-TTGCGGCCAGCGGCCGCTCTCCAAACTTGAATCAATAAATTT-3’ and inserted into a dual luciferase psiCHECK2 backbone (Promega). RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech ...
-
bioRxiv - Plant Biology 2023Quote: ... LUC images were taken 2-3 days after infiltration by applying 1 mM Beetle luciferin (Promega) on adaxial leaf surface.
-
bioRxiv - Cancer Biology 2020Quote: ... cells were subjected to Caspase 3/7 activity measurement with Caspase-Glo assay kit (Promega, Madison USA). Briefly ...
-
bioRxiv - Immunology 2019Quote: Cell viability and caspase 3/7 activity were measured using Non-Radioactive Cell Proliferation Assay kit (Promega) and Caspase-Glo® 3/7 assay kit (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability and Caspase activity were detected with CellTiter-Glo 2.0 and CaspaseGlo-3/7 assay (Promega) respectively 2 days after transfection ...
-
bioRxiv - Genomics 2023Quote: ... the final selection was performed by 3% agarose electrophoresis (80 V, 2 h, 1 kB Promega ladder). The selected clones were preincubated in growth medium (15 ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then diluted 1:7 in Glo Lysis Buffer (Promega) and incubated 1:1 for 5 minutes in the dark in opaque 96 well plates with NanoGlo Substrate freshly diluted 1:50 in NanoGlo Buffer (Promega) ...
-
bioRxiv - Cancer Biology 2023Quote: ... day 5 and day 7 for each condition using the CellTiter-Glo (CTG) luminescence-based assay (Promega). Diluted CTG reagent (100 uL 1:4 CTG reagent to PBS ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL of cells were mixed with 20 μL of the CellTiter-Glo 2.0 Cell Viability Reagent or Caspase-Glo 3/7 Assay substrate (Promega). Luminescence was measured after 2 min incubation for CellTiter-Glo 2.0 or 30 min incubation for Caspase-Glo 3/7 Assay using the Synergy H1 microplate reader as above ...
-
bioRxiv - Cancer Biology 2023Quote: The 3-dimensional (3D) culture studies were performed using MCF-7 cells and low melting point agarose (Promega, Australia). Agarose was suspended in PBS at a concentration of 0.75% (w/v) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Genomics 2023Quote: ... at 0.5 uM or DMSO (vehicle) followed by measurement of Caspase activity via the Caspase-Glo 3/7 assay (Promega). Results are representative of at least 3 independent experiments ...
-
bioRxiv - Microbiology 2019Quote: ... For transfection 0.5 or 2 µg of plasmid DNA in 25 or 200 µL serum-free medium were mixed with 1 or 4 µL of FuGENE HD transfection reagent (DNA to reagent ratio of 1:2, Promega, Mannheim, Germany) and incubated for 10 min at RT ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... and incubated with a 20 µg/ml solution of the HaloTag amine (O4) ligand (Promega) overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Neuroscience 2020Quote: Caspase 3/7 activity in primary neuronal cells was measured using ApoTox-Glo Triplex Assay kit (Promega, Madison, WI, USA) as per the manufacture’s instruction ...
-
bioRxiv - Microbiology 2020Quote: Apoptosis induction by T3DC and inhibition by Z-VAD-FMK was determined using the Caspase-Glo 3/7 Assay System (Promega). PC3 cells were plated at 1 × 104 cells per 96 well plate and 24 h later were either treated with docetaxel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Cell Biology 2020Quote: Measurements of caspase activities in cells were performed using the commercially available Caspase-Glo 3/7 Assay (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Microbiology 2019Quote: ... Cross-links of input and IP material were reversed by adding 10 μl 5 M NaCl and 4 μl 10 mg ml−1 Proteinase K (Promega), and incubated for 4 hours at 65°C ...
-
bioRxiv - Genetics 2023Quote: ... Ovation Methyl-Seq kits to prepare RRBS libraries (with added Promega unmethylated cl857 Sam7 lambda control spike-in of 1 ng per 80-120 ng of sample) ...
-
bioRxiv - Genomics 2020Quote: ... 4 µL RNase-A (4 mg-mL-1, Promega, Madison WI) was incubated at 37 °C for one hour vortexing every 15 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).