Labshake search
Citations for Promega :
401 - 450 of 4943 citations for 7 Boc 3 chloro 5 6 7 8 tetrahydroimidazo 1 2 a pyrazine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then pelleted at 300g for 7 minutes and resuspended in 200μL of Homogenization Buffer from the Maxwell RSC simplyRNA Tissue Kit (Promega #AS1340). Cells were then lysed by adding 200μL of lysis buffer and transferred into the Maxwell RSC Cartridge ...
-
bioRxiv - Cancer Biology 2019Quote: ... Organoid viability was assessed at 7 days post-transfection using the CellTiter-Glo® Luminescent Cell Viability Assay kit (Promega), as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... the whole lane was cut in 7 bands and digested, as described (Shevchenko et al, 1996) with sequencing-grade trypsin (Promega). For the ubiquitination analysis ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell number was measured after 3 and 7 days and normalized to the initial reading at day 0 using the CellTiter Glo Luminescent Cell Viability Assay (Promega). The experiments shown represent fold change at day 7 relative to day 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MCF-7/CA-IX cell lines by standard clonogenic stable cell construction procedures using Fugene HD (Promega, E 2311). The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001 ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Neuroscience 2024Quote: ... The WT and mutated 5’UTR sequences were ligated into a linearized reporter plasmid (psiCHECK-2 vector, Promega). The entire sequences of all the plasmids were validated by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... (49) as a negative control (2 μg of DNA per well of 6 well plate) with FuGene transfection reagent (Promega, Madison, WI) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated for an additional 2 – 6 days and cell growth was quantified using CellTiter-Glo® 2.0 Reagent (Promega, Cat. #924C). For immunoblot analysis ...
-
bioRxiv - Physiology 2023Quote: ... UMR106 cells were plated at 4 × 105 per well in a 6-well plate and transfected with 2 µg of NFAT5 gRNAs per well using the FuGENE® HD Transfection Reagent (Promega, USA). 24 h post-transfection ...
-
bioRxiv - Genetics 2023Quote: ... 3,500,000 cells were seeded in 10 cm plates (2-4 per replicate) and transfected with FuGENE® 6 Transfection Reagent (Promega, E2692). In one tube ...
-
bioRxiv - Molecular Biology 2023Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transiently transfected with 1 or 2 µg HaloTag-Ubiquitin (N2721, Promega) or the control vector pHTN HaloTag CMV-neo (G7721 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM CaCl2) and incubated for 4 hours with 1 µg trypsin (Promega) at 37°C and shaking at 1200 rpm ...
-
bioRxiv - Molecular Biology 2021Quote: ... were inserted using XhoI and NotI sites in 3’ UTR of Renilla gene in the psiCheck-2 dual luciferase reporter vector (Promega). The reporter in the amount of 25 ng and plasmids with different NORAD variants in the amount of 200 ng were introduced per 30,000 cells in 24-well plates ...
-
bioRxiv - Synthetic Biology 2019Quote: The wild type and mutant 3’ UTR of BRCA1 were constructed into psi-check-2 vector (Promega, Madison, WI, USA). Cells were plated in 24-well plates and the plasmids (psi-check-2-WT ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: Protein-protein interactions between Mkl1/2 and Foxo1/3/4 or glucocorticoid receptors were also measured using NanoBiT PPI Starter Systems (Promega). 293FT cells were seeded in 96-well white wall microplates and co-transfected with the LgBiT and SmBiT plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...