Labshake search
Citations for Promega :
551 - 600 of 4012 citations for 7 Benzylamino 4 nitrobenz 2 oxa 1 3 diazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Microbiology 2019Quote: ... The next day they were transfected over 24 hours with a DNA-Fugene HD mixture at a ratio of 1 μg DNA to 3 μl Fugene (Promega, Southampton, UK) according to the manufacturer’s instructions (Western analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed on the ViiA 7 Real-Time PCR System using GoTaq qPCR master mix (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... The mixture was then and incubated for 7min at 55°C followed by an additional 7 minute incubation with 3.5µl of SDS 0.2% (Promega, #V6551) to ensure that Tn5 was dissociated from the cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... ATP levels at day 0 and day 7 were measured using CellTiter-Glo Luminescent Cell Viability Assay (Promega). For analysis ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20,000 to 50,000 cells were lysed in the transposase reaction mix (12.5 μl 2xTD buffer, 2 μl TDE1 [Illumina], 10.25 μl nuclease-free water, and 0.25 μl 1% digitonin [Promega]) for 30 min at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... benthamiana leaves were collected at 2 dpi sprayed with a solution of 1 mM D–luciferin (Promega, E1603) and 0.02% (v/v ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Microbiology 2020Quote: ... Virus-mAb-containing media was then aspirated from cells and 100 mL of a 1:4 dilution of Bio-glo (Promega, G7940) in PBS was added to cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lysates were centrifuged at 500 g for 5 min at 4°C and resuspended in 4 mL of nuclei wash buffer (PBS supplemented with 1% BSA and 0.2U/μL RNasin® Plus Ribonuclease Inhibitor (Promega, N2615). Following another round of centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... Virus-mAb-containing media was then aspirated from cells and 100 μL of a 1:4 dilution of Bio-glo (Promega, G7940) in PBS was added to cells ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 ng of Renilla (pRL-CMV, Promega), and 0.12 μL of X-tremeGENE HP ...
-
bioRxiv - Genetics 2022Quote: ... 4 units RQ1 RNase-free DNase (Promega), protease and phosphatase inhibitor mix (Halt ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 U RNaseIn plus Ribonuclease Inhibitor (Promega), 1 mM NaF and 100 µM luciferin (Promega)] to a final volume of 15 µl with water ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 4 μg/ml RNase A (Promega) for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µl of RQ DNAse I (Promega), 21 µl of nuclease-free water and 5 µl of CaCl2 (10mM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 μL/well of Bright-Glo (Promega) was dispensed ...
-
bioRxiv - Genomics 2020Quote: ... 4 × Protease Inhibitor (Promega, Cat. No. G6521)] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 U/μl reverse transcriptase (Promega). 2 µl of cDNA were used for Real-Time PCR with self-designed primers and SYBR green reaction (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 ng of Renilla control plasmid (Promega) and 0.62 μL of Lipofectamine 2000 Transfection Reagent (InvitrogenTM) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 4 μl of FuGENE 6 (Promega) in 100 μl of OPTI-DMEM ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Neuroscience 2021Quote: Neuronal transfections were performed on DIV 7 using a calcium phosphate kit (ProFection Mammalian Transfection System, Cat # E1200, Promega), based on a previously described method (Sando et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... selected fragments of alternatively spliced exons (Supplementary Table 7) were cloned into the pGEM®-T Easy Vector (Promega). To generate the DNA templates for transcription ...