Labshake search
Citations for Promega :
401 - 450 of 1567 citations for 7 Amino 3 phenyl 2 benzopyrone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Neuroscience 2021Quote: Neuronal transfections were performed on DIV 7 using a calcium phosphate kit (ProFection Mammalian Transfection System, Cat # E1200, Promega), based on a previously described method (Sando et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... selected fragments of alternatively spliced exons (Supplementary Table 7) were cloned into the pGEM®-T Easy Vector (Promega). To generate the DNA templates for transcription ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then pelleted at 300g for 7 minutes and resuspended in 200μL of Homogenization Buffer from the Maxwell RSC simplyRNA Tissue Kit (Promega #AS1340). Cells were then lysed by adding 200μL of lysis buffer and transferred into the Maxwell RSC Cartridge ...
-
bioRxiv - Cancer Biology 2019Quote: ... Organoid viability was assessed at 7 days post-transfection using the CellTiter-Glo® Luminescent Cell Viability Assay kit (Promega), as per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... the whole lane was cut in 7 bands and digested, as described (Shevchenko et al, 1996) with sequencing-grade trypsin (Promega). For the ubiquitination analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... The sample was diluted 1:7 with 0.1 M NH4HCO3 before overnight digestion of proteins with trypsin (Promega, cat#V5113) at 30°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... the MCF-7 and MDA-MB-231 cells were infected with Plasmids expressing RFP or GFP using Fugene 6 (Promega) at an early passage and were selected using 2 μg/ml puromycin (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell number was measured after 3 and 7 days and normalized to the initial reading at day 0 using the CellTiter Glo Luminescent Cell Viability Assay (Promega). The experiments shown represent fold change at day 7 relative to day 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MCF-7/CA-IX cell lines by standard clonogenic stable cell construction procedures using Fugene HD (Promega, E 2311). The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001 ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...