Labshake search
Citations for Promega :
551 - 600 of 4130 citations for 7 AMINO 2 TERT BUTOXYCARBONYL 1 2 3 4 TETRAHYDROISOQUINOLINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl ViaFect™ (Promega, Madison, WI) and 40 µl Gibco Opti-MEM reduced serum media (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg/ml proteinase K (Promega, v3021)) at 37 °C overnight followed by addition of 10 μl of 3M potassium acetate and incubation at room temperature for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL RNasin RNase inhibitor (Promega). The transcription reaction was incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg Sequencing Grade Trypsin (Promega). The beads were shaken overnight at 37 °C and pelleted by centrifugation (1,400 rcf ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µg of sequencing grade trypsin (Promega) was then added to the samples and they were digested overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: The psiCHECK-2 control vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3′ UTR vector were described before26 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL dNTP (Promega U151B, 2.5 mM), 1.5 µL MgCl2 (25 mM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.05 μg LgBiT-β-arrestin-2 (Promega) plus 0.9 µg pcDNA3.1 for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL of luciferin reagent (Promega BrightGlo) was added and luciferase activity detected (Perkin Elmer Envision) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 U/µL RNasin Ribonuclease Inhibitor (Promega), 1.2 µM PrimeTime primers ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: Dual-luciferase assay (psiCHECK-2 vector, Promega) was selected to analyze the effects of the viral mutation on protein synthesis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We then added 2 μg trypsin (Promega) in 100 mM TEABC and incubated overnight at 30 °C ...
-
bioRxiv - Microbiology 2023Quote: ... and 2× GoTaq qPCR Master Mix (Promega). qPCR was performed using the MyGo Pro real-time PCR instrument (IT-IS Life Science Ltd.) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... containing a 2× concentration of Endurazine (Promega) was added to each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with 2 µg Trypsin (Promega) overnight at 37 °C shaking at 1200 RPM on a thermomixer ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1 and 2 μL of 50 ng/μL trypsin (in 100 mM TEABC, Promega) was added to the wells with single cells and two hundred carrier cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl of the resulting mRNA was mixed with 1 μl of FluoroTect GreenLys (Promega) and 3 μl of the wheat germ extract and then transferred under 50 μl of the translation buffer (1x SUB-AMIX SGC ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were again diluted to 2 M urea and digested with 1 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Systems Biology 2023Quote: The transfections were performed with a 1 mg DNA: 2 ml Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Immunology 2020Quote: ... The following day cells were transfected with plasmids encoding for FLAG-tagged NLRP1 (2 μg) or the indicated DPP9 construct (2 µg) with FuGENE HD according to manufacturer’s instructions (Promega). Cells were harvested ...
-
bioRxiv - Molecular Biology 2023Quote: ... precipitated proteins were eluted by incubation of beads with Elution Buffer (2 M Urea, 50 mM Tris pH 7.5, 2 mM DTT, 20 µg/ml Trypsin Gold (Promega)) for 30 min at 37°C shaking at 1,400 rpm in the dark ...
-
bioRxiv - Microbiology 2022Quote: ... the virus-induced cytopathogenic effect was measured colorimetrically by the formazan-based 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) cell viability assay (CellTiter 96 AQueous One Solution Cell Proliferation Assay from Promega, Madison, WI), and the antiviral activity was expressed as the 50% effective concentration (EC50) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... 3,500,000 cells were seeded in 10 cm plates (2-4 per replicate) and transfected with FuGENE® 6 Transfection Reagent (Promega, E2692). In one tube ...
-
bioRxiv - Developmental Biology 2020Quote: ... Digests were carried out in 4M urea 100mM HEPES with LysC (Wako, #121-05063, 1/100 (w/w) protease/substrates) for 3 h at 37C and subsequent trypsin digest (Promega, #V5280, 1/100 (w/w) protease/substrates ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then diluted 1:7 in Glo Lysis Buffer (Promega) and incubated 1:1 for 5 minutes in the dark in opaque 96 well plates with NanoGlo Substrate freshly diluted 1:50 in NanoGlo Buffer (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Biochemistry 2024Quote: HEK293T cells were transfected in a 6-well plate with 1 μg ADGRG6 DNA and 3 μL transfection reagent Fugene 6 (Promega, PRE2693) at 60-70% confluency and incubated for 48 h ...
-
bioRxiv - Microbiology 2020Quote: ... Assays were harvested on day 3 using BrightGlo luciferase reagent (Promega, Madison, WI) and luminescence detected with a Victor luminometer (PerkinElmer ...
-
bioRxiv - Pathology 2019Quote: ... RNA (3 μg) was retro-transcripted by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...