Labshake search
Citations for Promega :
351 - 400 of 4621 citations for 7 8 Dimethoxy 2 3 4 5 tetrahydro 1H benzo e 1 4 diazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 25 μL of 4 mM luciferin (Assay Reagent, Promega, E1291) supplemented with isoproterenol at a final concentration of 200 nM was added ...
-
bioRxiv - Microbiology 2023Quote: ... the protein suspension was digested with 4 μg trypsin (Promega) in 40 μL NH4HCO3 (50 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... After embedding in 4% low-melting point agarose (Promega, #V2111) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... and then 4 hours in mass-spectrometry-grade trypsin (Promega). The missed cleavage rate for samples was an average of 3.9%-21.9% ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Cell Biology 2019Quote: ... then alkylation solution was removed and gel pieces were hydrated for 45 min at 4 °C in digestion solution (5 ng/μl trypsin, sequencing grade, Promega, in 25 mM AB). The trypsin digestion proceeded for 2 hours at 37 °C on Thermomixer (750 rpm ...
-
bioRxiv - Cell Biology 2019Quote: ... then alkylation solution was removed and gel pieces were hydrated for 45 min at 4°C in digestion solution (5 ng/μl trypsin, sequencing grade, Promega, in 25 mM AB). The trypsin digestion proceeded for 2 hours at 37°C on Thermomixer (750 rpm ...
-
bioRxiv - Immunology 2020Quote: ... After a migration time of 4 h at 37°C (5 % CO2) lower compartment were analyzed for cell content by Cell-Titer-Glo® assay (Promega, Madison, WI, USA). Percentages of migrated cells were calculated as described before45 and normalized to the CXCL12-only control.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then diluted 1:7 in Glo Lysis Buffer (Promega) and incubated 1:1 for 5 minutes in the dark in opaque 96 well plates with NanoGlo Substrate freshly diluted 1:50 in NanoGlo Buffer (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... at a protein:Lys-C ratio of 100:1 (w/w) for 4 h at 37°C followed by trypsin (Promega) digestion at a ratio of 50:1 (w/w ...
-
bioRxiv - Cancer Biology 2022Quote: The 4T1-mScarlet and 67NR-GFP cell lines were generated by transfection using a 1:4 ratio of plasmid DNA:FugeneHD reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tryptic digests were performed overnight after addition of 46 μl of 100 mM Hepes pH 7.6 and 4 μl of 1 μg/μl Trypsin Gold (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... at room temperature (r.t.) for 4 hours and then further digested overnight with 1:50 (w/w) trypsin (Promega) at r.t ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µL of 1:100 (diluted in phenyl red-free DMEM with 4% FBS) Nano-Glo substrate (Promega N1572) was added in each well ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µl of cDNA (1:4 dilution) was added to a 20µl qPCR reaction using the GoTaq qPCR Master Mix (Promega) and ran on a BioRad CFX Opus96 thermocycler ...
-
bioRxiv - Biochemistry 2023Quote: BromoTag cell lines were generated in HEK293 cells via simultaneous transfection of two vectors at a 4:1 reagent:DNA ratio with FuGENE 6 (Promega). The first vector was a pMK-RQ vector containing 500 bp homology arms on either side of either an eGFP-IRES-BromoTag or eGFP-IRES-HiBiT-BromoTag sequence for integration into MCM4 and BRD4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... day 5 and day 7 for each condition using the CellTiter-Glo (CTG) luminescence-based assay (Promega). Diluted CTG reagent (100 uL 1:4 CTG reagent to PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Metabolic activity was measured at day 4 with CellTiter 96 (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Then 4 µL/well of Bright-Glo Luciferase detection reagent (Promega) was added to assay plates and incubated for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Then 4 μL/well of Bright-Glo luciferase detection reagent (Promega) was added to assay plates and incubated for 5 min at room temperature ...
-
bioRxiv - Physiology 2021Quote: ... and overnight protein digestion using 4 μg MS-grade trypsin (Promega) at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... by using 4 μL of FuGENE HD transfection reagent (Promega #E2311) according manufactured protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Then 4 μL/well of Bright-Glo Luciferase detection reagent (Promega) was added to assay plates and incubated for 5 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: RNA samples (4 ug) were mixed with random hexamers (Promega, #C118A) and heated at 70 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cell death was measured after 4 days using CytoTox Glo (Promega).
-
bioRxiv - Microbiology 2019Quote: Cells were harvested in 4 M guanidine thiocyanate (Promega, United States) in a 1% sodium lauryl sarcosine (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Resin was then washed 4 times with Resin Wash Buffer (Promega). Complexed proteins were eluted in SDS Elution Buffer (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... and overnight ligation at 4°C (T4 DNA ligase, Promega, USA). Ligated chimeras were transformed into DH5α (ThermoScientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 nM dT-primer and 4 U RNase Inhibitor (Promega, N2611). Reverse transcription was performed at 42°C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL of cells were mixed with 20 μL of the CellTiter-Glo 2.0 Cell Viability Reagent or Caspase-Glo 3/7 Assay substrate (Promega). Luminescence was measured after 2 min incubation for CellTiter-Glo 2.0 or 30 min incubation for Caspase-Glo 3/7 Assay using the Synergy H1 microplate reader as above ...
-
bioRxiv - Cancer Biology 2023Quote: The 3-dimensional (3D) culture studies were performed using MCF-7 cells and low melting point agarose (Promega, Australia). Agarose was suspended in PBS at a concentration of 0.75% (w/v) ...
-
bioRxiv - Genomics 2023Quote: ... at 0.5 uM or DMSO (vehicle) followed by measurement of Caspase activity via the Caspase-Glo 3/7 assay (Promega). Results are representative of at least 3 independent experiments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Microbiology 2021Quote: ... The protein solution was further diluted down to less than 2 M urea with 50 mM Tris-Cl (pH 8) and incubated with 2 μg of modified trypsin (w/w, 1∶50) (Promega, Madison, WI, USA) at 37°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 1h at 37°C in presence of random hexamers (Promega). qPCR primers (supplement Table 1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were diluted with 20 mM HEPES pH 8.0 to a urea concentration of 2 M and the proteins were digested with 4 µl Trypsin/LysC (Promega V5073: 20ug + 80uL 50mM acetic acid) for 4 hours at 37°C and boosted with an extra 2µl Trypsin/LysC (Promega V5073 ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were digested with 0.5 µg of lysyl endopeptidase (Wako) at room temperature for 4 hours and were further digested overnight with 1 µg trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were incubated at 37°C for 1 hour and then proteolytic digestion was performed with LysC (Wako) for 4 hours and trypsin (Promega) overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-m6A conjugated beads were incubated with purified mRNA with rotation at 4°C overnight in 300 µL MeRIP buffer with 1 µL RNase inhibitor (recombinant RNasin; Promega). 10% of the mRNA sample was saved as the input fraction ...