Labshake search
Citations for Promega :
201 - 250 of 4778 citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... RAC2 3’UTR-: 5’-TTGCGGCCAGCGGCCGCTCTCCAAACTTGAATCAATAAATTT-3’ and inserted into a dual luciferase psiCHECK2 backbone (Promega). RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... treated with 3 units/sample of DNase I for 2 hours (Promega, Madison, WI, USA), and 1-3μl aliquots were taken for reverse transcription (RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 2) chymotrypsin and lysyl endopeptidase (lys-C) (Fujifilm Wako) 3) lys-C and trypsin (Promega) and 4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 170 µL medium was removed and 30 µL caspase 3/7 reaction (1:100 Z-DEVD-R110 fluorogenic substrate:Homogenous buffer; ApoONE, Promega) was added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Bioengineering 2020Quote: The therapeutic effect of free taxane (pro)drugs and LNP formulations was determined by the [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) or the resazurin-based PrestoBlue assay (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were subjected to Caspase 3/7 activity measurement with Caspase-Glo assay kit (Promega, Madison USA). Briefly ...
-
bioRxiv - Immunology 2019Quote: Cell viability and caspase 3/7 activity were measured using Non-Radioactive Cell Proliferation Assay kit (Promega) and Caspase-Glo® 3/7 assay kit (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability and Caspase activity were detected with CellTiter-Glo 2.0 and CaspaseGlo-3/7 assay (Promega) respectively 2 days after transfection ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild type or mutant 3′-UTR of DKK3 was cloned into the psicheck-2 vector (Promega). HCT116 cells were transfected with and wild-type or mutant 3′-UTR-luc by using Lipofectamine 3000 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2-3 μg of the purified RNA was in vitro translated using wheat germ extract (Promega) at 25 °C for 2 h as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Cytotoxicity was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) assay kit (Promega) by determining Formazan absorbance at 590 nm on a Tecan Safire automated plate reader ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... Figure 6 and Figure 7) to form condensates in cells was monitored by transient transfection of U-2 OS cells using FuGene (Promega; Figures 2 and 7) or electroporation (as before ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL of cells were mixed with 20 μL of the CellTiter-Glo 2.0 Cell Viability Reagent or Caspase-Glo 3/7 Assay substrate (Promega). Luminescence was measured after 2 min incubation for CellTiter-Glo 2.0 or 30 min incubation for Caspase-Glo 3/7 Assay using the Synergy H1 microplate reader as above ...
-
bioRxiv - Cancer Biology 2023Quote: The 3-dimensional (3D) culture studies were performed using MCF-7 cells and low melting point agarose (Promega, Australia). Agarose was suspended in PBS at a concentration of 0.75% (w/v) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Genomics 2023Quote: ... at 0.5 uM or DMSO (vehicle) followed by measurement of Caspase activity via the Caspase-Glo 3/7 assay (Promega). Results are representative of at least 3 independent experiments ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...