Labshake search
Citations for Promega :
151 - 200 of 5619 citations for 6H Dipyrido 3 2 b 2' 3' e 1 4 diazepin 6 one 11 ethyl 5 11 dihydro 8 2 hydroxyethyl 5 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and pVSV-G (4:3:1 ratio) using calcium phosphate transfection (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... 3,500,000 cells were seeded in 10 cm plates (2-4 per replicate) and transfected with FuGENE® 6 Transfection Reagent (Promega, E2692). In one tube ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5–10 embryos were collected at 3 hpf and lysed in Passive Lysis Buffer (Promega) containing cOmplete Protease Inhibitor Cocktail (Sigma‒Aldrich) ...
-
bioRxiv - Biochemistry 2024Quote: ... Viability of MV-4-11 cells was assessed using the CellTiterGlo 2.0 kit from Promega (as per manufacturer instructions); viability of HPAFII cells was assessed using PrestoBlue reagent from Thermo Fisher (as per manufacturer instructions) ...
-
bioRxiv - Physiology 2021Quote: ... allowing measurement of 2-deoxyglucose-6-phosphate using the Glucose Uptake-Glo assay (Promega) and a FLUOstar Omega luminescence plate reader.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2019Quote: ... 5% CO2 CellTiter 96 Aqueous One Solution (Promega, #G3582) was added to measure cell proliferation ...
-
bioRxiv - Biochemistry 2021Quote: ... 11S protein was detected with a rabbit polyclonal antibody from Promega, and Tom40 with a rabbit polyclonal antibody produced by Cambridge Research Biochemicals (Billingham ...
-
bioRxiv - Immunology 2021Quote: ... SIV pseudovirus Env construct was cotransfected with env-deficient backbone plasmid (pSG3ΔEnv) in a 1:2 ratio with transfection reagent FuGENE 6 (Promega) in HEK 293T cells according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... were transfected 2 days after plating with 1 μg of total DNA with FuGENE 6 transfection reagent (E2691; Promega) at a ratio 1:3.
-
bioRxiv - Neuroscience 2022Quote: DNA constructs with different WT and mutated 5’UTRs of mouse Sox2 mRNA were assembled in the psiCheck-2 vector (Promega) including synthetic Renilla luciferase gene (hRluc ...
-
bioRxiv - Biochemistry 2022Quote: ... 2ml of Sf9 cells at 0.5×106 cells per ml were transfected with 2 µg of fresh bacmid DNA and FuGene HD transfection reagent (Promega) at a ratio of 3:1 transfection reagent to DNA ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Molecular Biology 2019Quote: 25μL of Caspase-Glo®-3/7 or −8 reagent (Promega) was added to 5μg (Caspase-3/7 activity ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Physiology 2019Quote: ... 2 μL sequencing-grade trypsin (1 μg/μL; Promega) was added for the digestion at 37°C for 12 h ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μl of 1% Digitonin in DMSO (Promega (2%), Cat ...
-
bioRxiv - Genomics 2021Quote: ... RNA concentration was measured in a DeNovix DS-11 spectrophotometer (DeNovix Inc, USA) and 4 μg of RNA were subjected to DNAse treatment (RQ1 - Promega) according manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 and 6 d using a CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (G3582; Promega, Madison, WI). Cells were incubated with the MTS reagent 3-4 h ...
-
bioRxiv - Cancer Biology 2021Quote: Caspase 3/7 and 9 activities were assessed using a fluorescence-based Apo-ONE homogenous caspase 3/7 assay kit (Promega) and luminescence-based caspase-glo 9 assay system (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... grown for 48 h and then caspase 3/7 enzymatic activity determined using Apo-One Homogenous caspase 3/7 activity assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µl of 5x SSIV buffer and 2 µl of DNase (RQ1, Promega) was added ...
-
bioRxiv - Genetics 2020Quote: ... Cell growth after 4 days was measured using the CellTiterGlo 2 kit (Promega) and a GloMax luminometer (Promega) ...
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... 8 µL of a mix consisting of 2 µL deoxyribonucleotide triphosphate (dNTPs, Promega, Madison, Wisconsin, US), 4 µL 5x RT-buffer ...
-
bioRxiv - Systems Biology 2020Quote: ... Reduced proteins were alkylated and trypsin-digested for 1-2 hours in trypsin solution (2 mg/ml sequencing grade porcine trypsin (Promega)/100 mM Tris/10 mM iodoacetamide ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were diluted to a concentration of urea of 2 mol L-1 and digested overnight with the addition of 2 µl sequencing-grade trypsin (Promega). After digestion ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... plate lids were removed and 3 μL of CellTiter-Glo One (Promega) were added to each well by using a solenoid valve dispenser ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Biochemistry 2024Quote: HEK293T cells were transfected in a 6-well plate with 1 μg ADGRG6 DNA and 3 μL transfection reagent Fugene 6 (Promega, PRE2693) at 60-70% confluency and incubated for 48 h ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Plant Biology 2020Quote: ... using 3 - 5 μg of total RNA and 250 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the HIV 5’ LTR from the pNL4-3 isolate (Genbank AF324493) was cloned into pGL3-Basic (Promega) via Gibson assembly (NEB 2X HiFi ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...