Labshake search
Citations for Promega :
201 - 250 of 5125 citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and the Caspase-Glo 3/7 assay kit (#G8090, Promega, Nacka, Sweden) were used in 96-well plates (Sarstedt #82.1581.001 ...
-
bioRxiv - Microbiology 2021Quote: ... 4 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were seeded on 24 mm glass coverslips and transfected with 2 µg plasmid DNA (1:1.3:3 ratio LAMP1:ER:opto-kinesin) and Fugene6 transfection reagent (Promega 1:3) for 20-30 h prior to imaging ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then 1 µl (1-3 units) of T4 ligase (Promega, Madison, US) was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Biochemistry 2020Quote: ... or 5:1 (w/w) Elastase (Promega), using manufacturer recommended temperatures for 18 h with 600 rpm shaking ...
-
bioRxiv - Physiology 2024Quote: ... (Promega #E1941, diluted 1:5 with water). Dual-Glo Luciferase assays were performed to measure Firefly and Renilla luciferase activity (Promega #E2940) ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 0.2 μg of pMD2.G envelope plasmid using FuGENE 6 (Promega). Cells were incubated up to 48 hrs and then lentivirus-containing media was collected and concentrated with Lenti-X concentrator (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... then supplemented with 8 µL Trypsin/LysC (1 µg/µl; Promega, #V5072) and digested overnight at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was analyzed using Caspase-Glo 3/7 Assay (Promega, Madison, WI), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Neuroscience 2019Quote: ... caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega). Cell viability was detected using the CytoPainter Live Cell Labeling Kit (Abcam ...
-
bioRxiv - Biochemistry 2020Quote: ... the Caspase-Glo 3/7 reagent (G8092/G8093 kit; Promega, Madison WI, USA) was prepared at room-temperature according to the manufacturer′s specifications ...
-
bioRxiv - Biochemistry 2022Quote: ... Apoptosis was measured using the Caspase-Glo® 3/7 assay system (Promega). Cells were seeded at a density of 1 × 104 in 96-well black polystyrene microplates (Corning) ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was measured with the caspase-Glo 3/7 assay (Promega Cat# G8092), following manufacturer recommendations.
-
bioRxiv - Molecular Biology 2022Quote: Active caspases were detected using the Caspase-Glo 3/7 Assay System (Promega). The experiment was set up using the same protocol as proliferation assay ...
-
bioRxiv - Neuroscience 2023Quote: ... Caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Flo (Promega) or CaspaseGlo (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Glo (Promega) or Caspase Glo (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Caspase Glo® 3/7 Assay (Promega Corporation, Madison, WI, USA) following the manufacturer’s protocol and plates were read on an EnVision Multilabel Plate Reader (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and apoptosis was determined using the Caspase 3/7 Glo Assay (G8090, Promega) measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... plate lids were removed and 3 μL of CellTiter-Glo One (Promega) were added to each well by using a solenoid valve dispenser ...
-
bioRxiv - Microbiology 2020Quote: ... with m7G(5')ppp(5')G RNA Cap Structure Analog (ref. S1404L, Promega) as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... psPAX2 and pMD2.G at the ratio of 1:1:1 in HEK293T cells using ProFection Mammalian Transfection System (Promega, E1200), medium was changed 16h post transfection and virus containing supernatant was harvested 48h later ...
-
bioRxiv - Microbiology 2023Quote: ... Luciferase activity was quantified 7 hours post infection using the ONE-Glo Luciferase Assay System (Promega, E6110) in combination with the PerkinElmer EnVision plate reader.
-
bioRxiv - Microbiology 2019Quote: ... Cross-links of input and IP material were reversed by adding 10 μl 5 M NaCl and 4 μl 10 mg ml−1 Proteinase K (Promega), and incubated for 4 hours at 65°C ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... RNA (1 μ g) was retro-transcribed using random hexamers (Promega). The qRT-PCR reactions were performed in a Step One real time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μ g RNA was subjected to RQ1 DNase treatment (Promega) prior to reverse transcription reaction using Maxima H Minus First Strand cDNA Synthesis kit (Thermo Scientific ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... and pMD2.G (1 μg) using Fugene HD transfection reagent (Promega) into HEK 293T cells ...
-
bioRxiv - Biochemistry 2020Quote: ... Two control reactions were performed: one containing 8 units of HeLa nuclear extract provided by Promega as a positive control and the other containing no nuclear protein as a negative control ...
-
bioRxiv - Cell Biology 2020Quote: ... psPAX2 and pMD2.G at the ratio of 1:1:1 in HEK293T cells using ProFection® Mammalian Transfection System (Promega, E1200), medium was changed 16h post transfection and virus containing supernatant was harvested 48h later ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells for the luciferase assay were exposed to 100 μL of a 1:1 dilution of DMEM and luciferase substrate (ONE-Glo Luciferase Assay System, Promega), and luminescence from each well measured in a GloMax-96 Microplate Luminometer (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Cell Biology 2020Quote: ... Caspase 3/7 activity was measured using an Apolive-Glo kit (Promega, Madison, WI) and measured using a SpectraMax M5 (Molecular Devices ...
-
bioRxiv - Physiology 2020Quote: ... caspase 3/7 activity was measured using ApoLive-Glo Multiplex Assay (Promega, Madison, WI). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell apoptosis was assessed using either the CaspaseGlo 3/7 assay (G8090, Promega, UK) according to the manufacturer’s instructions (N=4 replicates) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Effector caspase activity was assessed using the Caspase-Glo 3/7 Assay System (Promega) following a previous protocol (Ronai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal volume of Caspase-Glo® 3/7 Assay System (Cat. No.G8090, Promega) was transferred into each well and incubated for 1 h and measured by a GloMax® 20/20 Luminometer ...