Labshake search
Citations for Promega :
301 - 350 of 5004 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 2 µL ROX (CRX reference dye, Promega, C5411) were added to 1 mL SybrGreen as a passive reference dye that allows fluorescent normalization for qPCR data ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of 100 bp DNA Ladder (Promega) was added to confirm amplicons size and run at 100 V for 45 mins ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with 2 μg trypsin (Promega, v511c), shaking overnight at 700 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the CellTiter-Blue assay (G8081/2, Promega) following the protocol of the manufacturer using an EnVision multimode plate reader (PerkinElmer) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2 µL of sequencing grade modified trypsin (Promega) at a concentration of 0.1 µg/μL and 23 µL of 50mM ammonium bicarbonate/0.01% ProteaseMax were added ...
-
bioRxiv - Biochemistry 2023Quote: Cell viability assays using CellTiter-Glo 2 (Promega) were performed according to the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Trypsin/LysC protease mix (2 µg/ µL, Promega) was added (1:25 protease ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl, 1 mM MgCl2, 2 mM EDTA, 1% NP-40, 1 mM DTT, 100 U/mL RNasin [Promega], 1X protease inhibitor) at 7 dpi ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... Digestion solutions were brought to a final concentration of 2 M urea and 2 mM CaCl2 and a second digestion was performed overnight at 37 °C using trypsin (Promega, v5280) at 1:100 w/w ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein material was reduced with tris(2-carboxyethyl) phosphine (TCEP; 10 mM final) and digested overnight with 2 μg sequence-grade modified trypsin Gold (Promega, V5280) in 50 mM ammonium bicarbonate (NH4HCO3 ...
-
bioRxiv - Microbiology 2021Quote: ... rSARS-CoV-2/Δ7a-Nluc or rSARS-CoV-2/Nluc-2A infected cells was quantified using Nano-Glo® Luciferase Assay System (Promega) following the manufacturers’ specification.
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Plant Biology 2019Quote: ... using 1 - 2 µg of total RNA and 250 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50°C ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transfected with 1 – 2 μg EphA2-mTurquoise plasmid DNA using FuGene HD (Promega, #E2311) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... urea was diluted to 1 M by adding 50 mM ammonium bicarbonate and 2 μg Trypsin (Promega) per 100 μg protein ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of GST-tagged effector proteins and 2 μl of FluoroTect™ GreenLys tRNA (Promega, USA) were gently mixed with High-Yield Wheat Germ Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... 1–2 μg of each RNA was treated with RNase-free Dnase I (Promega, Madison WI, USA) and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa) ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were treated with the CellTiter-Glo 2.0 Viability Assay (1:2 v/v; Promega, Madison, WI) using the Viaflo Assist Pipetting Platform (Integra Biosciences ...
-
bioRxiv - Microbiology 2023Quote: The assay was adapted from 15 where Hyp1-Nluc schizonts at 1% hematocrit and 1-2% parasitaemia were lysed in 1x NanoGlo buffer (Promega, USA) within a 96-well flat-bottom plate and parasite lysates were added to compounds and incubated for 10 minutes at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Microbiology 2019Quote: ... Cross-links of input and IP material were reversed by adding 10 μl 5 M NaCl and 4 μl 10 mg ml−1 Proteinase K (Promega), and incubated for 4 hours at 65°C ...
-
bioRxiv - Immunology 2021Quote: ... and 1 μg shRNA plasmid using Fugene 6 (Promega). The next day ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 μL of CellTiter Glo (Promega, diluted 1:6), was added to each well and luminescence was measured with an Envision plate reader ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Molecular Biology 2023Quote: SMC5/6 hexamer purified from E.coli with a C-terminal HALO tag on Nse2 was incubated with a 2-fold molar excess of Janelia-Fluor646 HaloTag Ligand (Promega; 12 µM Smc5/6 hexamer + 24 µM label). After incubation for 1 h at 25°C ...
-
bioRxiv - Genetics 2023Quote: ... Ovation Methyl-Seq kits to prepare RRBS libraries (with added Promega unmethylated cl857 Sam7 lambda control spike-in of 1 ng per 80-120 ng of sample) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM dNTP mix and RNasin Ribonuclease Inhibitors (Promega). This mixture was incubated at 25 °C for 10 min ...
-
bioRxiv - Cell Biology 2019Quote: ... alkylated and digested with 2 μg of Trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were digested with 2 μg Trypsin (Promega V5280) for 20 hrs at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... and 2 U/μL RNasin Plus RNase Inhibitor (Promega). We performed DNase digestion at 37 °C for 1 hour followed by a 95 °C inactivation for 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% (w/v) bisacrylamide (0.05% final concentration; V3141, Promega), 10× phosphate buffer saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2) an RNAse inhibitor (1µL/mL of RNasin - Promega) was added to all the solutions after the fixation/permeabilization step ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 μL T7 Express Enzyme Mix (Promega, P1320) and incubated at 37 °C for 4 hours unless otherwise indicated ...
-
bioRxiv - Biophysics 2022Quote: ... and then digested with 2 μg of trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 μg Sequencing Grade Modified Trypsin (Promega, Madison, WI) was added to each sample and digested overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... comprised of 2% (v/v) of GloSensor reagent (Promega, #E1290 ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of Wizard DNA Clean-Up resin (Promega) was added to the solution and mixed by inversion for two minutes ...
-
bioRxiv - Biophysics 2020Quote: ... 2 x GoTaq®qPCR Master Mix (Promega, Switzerland) and 1 μl cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... the sample was digested with trypsin (2 μg, Promega) in 50 mM ammonium bicarbonate (100 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... (2) DNA template degradation by the DNaseI free (Promega), and (3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 2 µl of Fugene HD transfection reagent (Promega). The control reporter plasmid was transfected in parallel in equimolar amounts with pEGFP or pPRKRA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 μL of 20-fold diluted furimazine stock (Promega) in live cell substrate (LCS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL of CellTiter-Glo reagent (Promega, cat # G9683) was dispensed to each microplate well via BioRAPTR FRD ...