Labshake search
Citations for Promega :
401 - 450 of 2815 citations for 6 methyl 4 oxo 5 6 dihydro 4H thieno 2 3 b thiopyran 2 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Cancer Biology 2023Quote: ... and their numbers were measured every 2–4 days using the CellTitre-Glo 3D cell viability assay (Promega), as described by the manufacturer ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfection was performed in the 6-well culture plate using FuGene-HD (Promega, E2311) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Retrovirus was produced in Phoenix Amphotropic cells by transfection with FUGENE 6 (Promega E2692) of pLPC-TRF2 or pLPC-Empty ...
-
bioRxiv - Cell Biology 2021Quote: ... and a pcDNA5/FRT plasmid of interest using the Fugene 6 transfection kit (Promega) or Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were collected at day 6 and measured by CellTiter-Glo (Promega #PR-G7573) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: HEK 293T cells grown on 10 cm dish were transfected using FuGENE 6 (Promega) with the transfer vector pxPAX2 (Addgene #12260 ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected with 0.4 µg DNA using FuGENE 6 transfection reagent (Promega) in a 1:3 µg DNA:µL FuGENE ratio 48 h before electrophysiology measurements were performed.
-
bioRxiv - Immunology 2020Quote: ... China) or the D614G variant (constructed by site-directed mutagenesis) using FuGENE 6 (Promega). The next day ...
-
bioRxiv - Developmental Biology 2020Quote: ... For the immunolabeling experiment HeLa cells were transfected with plasmids using FuGENE 6 (Promega). For streptavidin pull-down assays from HEK293T cells ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Transfection with plasmid was performed following standard protocols for Fu gene 6 (Promega, #E2691). Cells were selected for stable expression using Geneticin (G418 sulfate ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μg of both plasmids was mixed with 6 μl FuGENE reagent (Promega E269A) in 200 μl serum free DMEM and incubated for 30 minutes before adding the transfection mix to the cells ...
-
bioRxiv - Biophysics 2021Quote: ... U2OS cells transfection with engineered lentiCRISPRv2 were done using FuGENE 6 transfection reagent (Promega). Positive clones were selected using puromycin and subsequently isolated.
-
bioRxiv - Cell Biology 2022Quote: ... Bacmids were transfected to Sf9 insect cells by lipofection (FuGENE 6 Transfection Reagent, Promega), to generate baculovirus ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of both plasmids was mixed with 6 μl FuGENE reagent (Promega E269A) in 200 μl serum free DMEM and incubated for 30 min before adding the transfection mix to the cells ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with MX2-mScarlet vector using FuGENE 6 transfection reagent (#E2691, Promega) following the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were collected at day 6 and measured by CellTiter-Glo (Promega #PR-G7573). Cell viability values were analyzed following blank cell deductions and normalization to vehicle readings ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with TPMT-FLAG or TPMT A80P-FLAG with FuGENE 6 (Promega). 24 h post transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...