Labshake search
Citations for Promega :
401 - 450 of 1238 citations for 6 Methy 1H indazol 5 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Immunology 2021Quote: ... in a mixture with 20 μl OptiMEM and 1μl FuGENE HD or FuGENE 6 (Promega E2691) per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) for 6 hours and trypsin (Trypsin Gold, Promega) overnight.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were cultured in DMEM+10% FBS+Penicillin/Streptomycin and transfected using FuGENE 6 (Promega). Co-recruitment assays were performed 24 hours after transfection ...
-
bioRxiv - Immunology 2020Quote: All VLPs were produced by transient transfection of HEK293T cells with Fugene 6 (Promega, ref E2691). HEK293T were seeded in 15-cm dishes to reach 60-70% confluency the next day and VLPs were produced by co-transfecting plasmids encoding Gag-eGFP and the VSV-G envelope (pGag-EGFP and pCMV-VSV-G ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: Three wells of a 6-well plate were lysed were lysed in Reporter lysis buffer (Promega) for 10 min on ice before centrifugation at 17,000 g ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were lysed 6 hours after poly I:C transfection using 100μL 1X passive lysis buffer (Promega). Plates were frozen for at least 30 minutes at −80°C before thawing and reading on a GloMax Multi plate reader (Promega) ...
-
bioRxiv - Microbiology 2021Quote: All virus stocks were produced by plasmid transfection of HEK 293T cells with Fugene 6 (Promega). Supernatants were harvested at 48h and 72h ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV-hyPBase was performed using 500 ng each DNA and 6 μl of FugeneHD (Promega) as per manufacturer’s instructions20,49,50 ...
-
bioRxiv - Biochemistry 2022Quote: ... Sf21 insect cells were transfected with PLP/DM20 bacmid using Fugene 6 transfection reagent (Promega Corp.) and baculoviruses were collected and used for preparation of a high-titer virus stock ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were examined for viability every 4 to 6 weeks with the CellTiter-Glo assay (Promega). Cell viability was measured in quadruplicates by seeding the cells (2,000 to 3,000 per well in 96-well plate) ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Immunology 2019Quote: ... plasmids encoding Env were cotransfected with an Env-deficient backbone plasmid (pSG3DENV) using Fugene 6 (Promega). Virus-containing supernatants were harvested 48 hr post-transfection ...
-
bioRxiv - Immunology 2019Quote: ... plasmids encoding Env were cotransfected with an Env-deficient backbone plasmid (pSG3DENV) using Fugene 6 (Promega). Virus-containing supernatants were harvested 48 hr post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... proteins were digested for 6 h at 37°C with 4ng.μL−1 of modified trypsin (Promega) dissolved in 50 mM NH4CO3 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... To transform the bacmid into Sf9 cells the transfection reagent FuGene 6 (Promega Corporation, Madison, USA) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were transfected with the pseudovirus encoding plasmids using FuGENE 6 Transfection Reagent (Promega). The virus culture supernatant was harvested at 48h and 72h post transfection and stored at -80°C until use ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell viability was assessed at day 6 post inhibitor treatment using CellTiter Glo 3D (Promega) according to manufacturer’s instruction.
-
bioRxiv - Cell Biology 2022Quote: Lipofectamine 3000 or FuGENE 6 transfection reagents (ThermoFisher Scientific/Invitrogen, cat# L3000008; and Promega, cat# E2691) were used for transient delivery of PRR14 plasmids ...
-
bioRxiv - Genetics 2023Quote: ... Transient expression of NSD2 VUS in HeLa cells was performed using FuGENE 6 (Promega, WI, USA). pCMV-3xFLAG-NSD2 and pCMV-3xFLAG-NSD2 c.2714C>T plasmids were constructed by VectorBuilder (IL ...
-
bioRxiv - Biophysics 2023Quote: We stably transfected U2OS cells with this plasmid using Fugene 6 following the manufacturer’s instruction (Promega). α-Amanitin (SIGMA #A2263 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5μg of plasmid was transfected into 6-well dishes using Fugene HD (Promega, Madison, WI, USA) with 3:1 transfection reagent to DNA for 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells plated for transfection were allowed to reach 70% confluency and transfected with FuGene 6 (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... then transfected with 4 μg pLZRS-GCaMP6 DNA plus 12 μl FuGENE 6 (Promega Cat. #E2691) in 800 μl of Opti-MEM (Thermo-Fisher Cat ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells were transfected using 2 µg of plasmid DNA and 6 µL of FuGENE (Promega) for gene editing or using a NEPA21 electroporation system (Nepa Gene ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transiently transfected with 1.5 μg of plasmid using FuGENE 6 transfection reagent (#E2692, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 6-8 hours before dual luciferase assay was performed using the Dual-Glo Luciferase Assay (Promega) in a Synergy Neo2 microplate reader (Biotek).
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid transfection of U2OS cells with PIF1 variants was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were plated at 100,000cells in 2 ml media onto 35mm MatTek glass bottom dishes and transfected with 0.9µg RUSH plasmid and 0.1µg eGFP-GalT or LAMP1-GFP using 100µl Opti-MEM and 3µl Fugene 6 transfection reagent (Promega) one day before imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were washed again and 6 µg of plasmid DNA was added with FugeneHD transfection reagent (Promega). Supernatants were collected at 24 ...