Labshake search
Citations for Promega :
51 - 100 of 2707 citations for 6 METHYL 3 1H TETRAZOL 5 YL 4H CHROMEN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Cancer Biology 2021Quote: Caspase 3/7 and 9 activities were assessed using a fluorescence-based Apo-ONE homogenous caspase 3/7 assay kit (Promega) and luminescence-based caspase-glo 9 assay system (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... grown for 48 h and then caspase 3/7 enzymatic activity determined using Apo-One Homogenous caspase 3/7 activity assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl/well of CellTiter 96 Aqueous One Solution (Promega, Madison, WI) was added to the bottom wells and the absorbance at 490 nm (A490 ...
-
bioRxiv - Molecular Biology 2022Quote: ... One to 5 µg of RNA were digested with DNase (Promega M6101) and reverse-transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems 4368813) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 μg sample was then digested by one of the following proteases: trypsin (Promega) and elastase (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Physiology 2021Quote: ... and 5 μg lentiviral construct with 30 μL Fugene 6 (Promega) the following day ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were pulsed for 4 h with CellTiter 96 Aqueous One solution reagent (Promega). Cell viability was measured by a luminometer ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 3’UTR-: 5’-TTGCGGCCAGCGGCCGCTCTCCAAACTTGAATCAATAAATTT-3’ and inserted into a dual luciferase psiCHECK2 backbone (Promega). RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech ...
-
bioRxiv - Biochemistry 2024Quote: HEK293T cells were transfected in a 6-well plate with 1 μg ADGRG6 DNA and 3 μL transfection reagent Fugene 6 (Promega, PRE2693) at 60-70% confluency and incubated for 48 h ...
-
bioRxiv - Cell Biology 2020Quote: ... washed again in DPBS and stained with 1mg/ml X-gal (5-bromo-4-chloro-3-indolyl-β-galactopyranoside, Promega, Madison, WI, US) in DMF (Dimetil formamide ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was revealed with a solution of NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate) (Promega, Madison, WI, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... The migrated cells were collected at 4h and quantified with Cell Titre-Glo 2.0 reagent (#G9241, Promega). For inhibitor experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 4h at 37C in 6M urea followed by an overnight trypsin digestion (1:25 ratio; Promega) at 37C in 1M urea ...
-
bioRxiv - Cancer Biology 2022Quote: ... and samples were digested over night with Lys-C (Wako) followed by 4h digestion with Trypsin (Promega) at room temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: To measure luciferase activity on plaque containing LB-agar plates, 5 μl of the diluted (1:50, in PBS) NanoLuc® luciferase substrate 2-furyl methyl-deoxy-coelenterazine (Furimazine; Promega) were dropped onto the respective plaques ...
-
bioRxiv - Genomics 2020Quote: ... 500 cells were plated in each well of 96-well-plate and each sample had 6 replicates and monitored for 6 days from day 0 to day 5 by CellTiter-Glo 2.0 Assay (Promega, G9242) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... apoptosis was quantified using the Apo-ONE homogeneous caspase-3/7 assay kit (Promega, Madison, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... was determined at day 3 and 4 post-transfection using the Caspase-Glo 3/7 Assay (Promega, Mannheim, Germany). The emerging fluorescence was detected (485Ex/527Em ...
-
bioRxiv - Microbiology 2021Quote: ... and pVSV-G (4:3:1 ratio) using calcium phosphate transfection (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 1h at 37°C in presence of random hexamers (Promega). qPCR primers (supplement Table 1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Forty-eight hours later, cells were treated with Thapsigargin (100nM, 4h) and cells were resuspended in passive lysis buffer (Promega). Firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay system (#E1960 ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ...