Labshake search
Citations for Promega :
601 - 650 of 2237 citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... proteins were digested for 6 h at 37°C with 4ng.μL−1 of modified trypsin (Promega) dissolved in 50 mM NH4CO3 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... To transform the bacmid into Sf9 cells the transfection reagent FuGene 6 (Promega Corporation, Madison, USA) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were transfected with the pseudovirus encoding plasmids using FuGENE 6 Transfection Reagent (Promega). The virus culture supernatant was harvested at 48h and 72h post transfection and stored at -80°C until use ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell viability was assessed at day 6 post inhibitor treatment using CellTiter Glo 3D (Promega) according to manufacturer’s instruction.
-
bioRxiv - Cell Biology 2022Quote: Lipofectamine 3000 or FuGENE 6 transfection reagents (ThermoFisher Scientific/Invitrogen, cat# L3000008; and Promega, cat# E2691) were used for transient delivery of PRR14 plasmids ...
-
bioRxiv - Genetics 2023Quote: ... Transient expression of NSD2 VUS in HeLa cells was performed using FuGENE 6 (Promega, WI, USA). pCMV-3xFLAG-NSD2 and pCMV-3xFLAG-NSD2 c.2714C>T plasmids were constructed by VectorBuilder (IL ...
-
bioRxiv - Biophysics 2023Quote: We stably transfected U2OS cells with this plasmid using Fugene 6 following the manufacturer’s instruction (Promega). α-Amanitin (SIGMA #A2263 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5μg of plasmid was transfected into 6-well dishes using Fugene HD (Promega, Madison, WI, USA) with 3:1 transfection reagent to DNA for 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells plated for transfection were allowed to reach 70% confluency and transfected with FuGene 6 (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transiently transfected with 1.5 μg of plasmid using FuGENE 6 transfection reagent (#E2692, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Plant Biology 2021Quote: ... the protein suspensions were digested with 4 μg trypsin (Promega) in 40 μl TEAB buffer overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 25 μL of 4 mM luciferin (Assay Reagent, Promega, E1291) supplemented with isoproterenol at a final concentration of 200 nM was added ...
-
bioRxiv - Microbiology 2023Quote: ... the protein suspension was digested with 4 μg trypsin (Promega) in 40 μL NH4HCO3 (50 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... After embedding in 4% low-melting point agarose (Promega, #V2111) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... and then 4 hours in mass-spectrometry-grade trypsin (Promega). The missed cleavage rate for samples was an average of 3.9%-21.9% ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl ViaFect™ (Promega, Madison, WI) and 40 µl Gibco Opti-MEM reduced serum media (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg/ml proteinase K (Promega, v3021)) at 37 °C overnight followed by addition of 10 μl of 3M potassium acetate and incubation at room temperature for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL RNasin RNase inhibitor (Promega). The transcription reaction was incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg Sequencing Grade Trypsin (Promega). The beads were shaken overnight at 37 °C and pelleted by centrifugation (1,400 rcf ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µg of sequencing grade trypsin (Promega) was then added to the samples and they were digested overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: The psiCHECK-2 control vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3′ UTR vector were described before26 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL dNTP (Promega U151B, 2.5 mM), 1.5 µL MgCl2 (25 mM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.05 μg LgBiT-β-arrestin-2 (Promega) plus 0.9 µg pcDNA3.1 for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL of luciferin reagent (Promega BrightGlo) was added and luciferase activity detected (Perkin Elmer Envision) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 U/µL RNasin Ribonuclease Inhibitor (Promega), 1.2 µM PrimeTime primers ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: Dual-luciferase assay (psiCHECK-2 vector, Promega) was selected to analyze the effects of the viral mutation on protein synthesis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We then added 2 μg trypsin (Promega) in 100 mM TEABC and incubated overnight at 30 °C ...
-
bioRxiv - Microbiology 2023Quote: ... and 2× GoTaq qPCR Master Mix (Promega). qPCR was performed using the MyGo Pro real-time PCR instrument (IT-IS Life Science Ltd.) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... containing a 2× concentration of Endurazine (Promega) was added to each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with 2 µg Trypsin (Promega) overnight at 37 °C shaking at 1200 RPM on a thermomixer ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 6-8 hours before dual luciferase assay was performed using the Dual-Glo Luciferase Assay (Promega) in a Synergy Neo2 microplate reader (Biotek).
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid transfection of U2OS cells with PIF1 variants was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were plated at 100,000cells in 2 ml media onto 35mm MatTek glass bottom dishes and transfected with 0.9µg RUSH plasmid and 0.1µg eGFP-GalT or LAMP1-GFP using 100µl Opti-MEM and 3µl Fugene 6 transfection reagent (Promega) one day before imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were washed again and 6 µg of plasmid DNA was added with FugeneHD transfection reagent (Promega). Supernatants were collected at 24 ...