Labshake search
Citations for Promega :
651 - 700 of 4173 citations for 6 Cyclopentadecen 1 one 3 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The pool was quantified by Fluorometry using the QuantiFluor ONE dsDNA System (#E4871, Promega). Libraries were sequenced Paired-End 38 bases (in addition ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were lysed in 100 μl of One-Glo Luciferase Assay Reagent (Promega). Firefly luciferase activity was determined with a Centro LB960 luminometer ...
-
bioRxiv - Systems Biology 2020Quote: ... There were two positive controls: one was pGL4.10 vector (Promega, with luc2 firefly gene) with pTran promoter inserted between NheI and XhoI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... Luciferase activity was measured with the ONE-Glo™ Luciferase Assay System (E6120; Promega) using the GloMax® Discover Microplate Reader according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... one of the replicate samples was treated with Calf intestinal alkaline phosphatase (Promega, M182A) for 60 min at 37°C.
-
bioRxiv - Immunology 2022Quote: ... After 17-20 hours VSV 40 μL/well of One-Glo-EX substrate (Promega) was added to the cells and incubated in the dark for 5-10 min prior reading on a BioTek plate reader ...
-
bioRxiv - Immunology 2022Quote: ... and luciferase activity was measured using One-Glo luciferase assay system (Promega, Cat# E6130). The assay of each serum was performed in duplicate ...
-
bioRxiv - Microbiology 2020Quote: ... Firefly luciferase activity (RLU) was measured using ONE-Glo™ Luciferase Assay System (Promega) and FlexStation.
-
bioRxiv - Microbiology 2020Quote: ... Luciferase activity was then measured using the ONE-Glo™ luciferase assay (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and luciferase activity (RLU) was measured using ONE-Glo™ Luciferase Assay System (Promega) and read on Clariostar Plus Microplate Reader (BMG Labtech).
-
bioRxiv - Cell Biology 2020Quote: ... MTS assay (G3582, CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega, UK) was performed for colorimetric quantification of viability ...
-
bioRxiv - Systems Biology 2019Quote: ... cell viability was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) kit and absorbance was quantified on a microplate reader (TECAN) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library concentrations were estimated using QuantiFluor ONE ds DNAsystem on a Quantus fluorometer (Promega). Pooled libraries were sequenced on NextSeq 500 with NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CellTiter 96® Aqueous One Solution Cell Proliferation Assay Kit was purchased from Promega AG (Dübendorf ...
-
bioRxiv - Neuroscience 2021Quote: ... and 25 uL of lysate was mixed with ONE-Glo luciferase assay buffer (Promega) in opaque 96-well plates ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability was assessed using MTS1-based CellTiter 96® AQueous One System (Promega). Absorbance of cell culture medium recorded at 490 nm using a Synergy Neo2 microplate spectrophotometer (Biotek ...
-
bioRxiv - Microbiology 2020Quote: One μg of total RNA was treated with 0.4 units of DNase I (Promega) and 0.2 units of Turbo-DNase (Ambion ...
-
bioRxiv - Microbiology 2021Quote: Cell viability was assessed using the CellTiter 96 AQueous One Solution Reagent (Promega, Madison). This method determines the number of viable cells based on conversion of formazan product from 3-(4,5-dimethylthazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolim by nicotinamide adenine dinucleotide phosphate (NADPH ...
-
bioRxiv - Immunology 2022Quote: ... CellTiter96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega Corp, Madison, Wisconsin, USA) was added to each well as recommended by manufacturer and incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: Luciferase assays in vitro were performed using the ONE-Glo Luciferase Assay System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2022Quote: ... 50 µL of ONE-Glo™ luciferase assay substrate (Promega Corporation, Madison, Wisconsin, USA) was added and cells were incubated for 10 min at RT on a shaker ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were lysed in 100 μl of One-Glo Luciferase Assay Reagent (Promega). Firefly luciferase activity was determined with Infinite F200 pro system (Tecan).
-
bioRxiv - Immunology 2023Quote: ... and luciferase activity (RLU) was measured using the ONE-GloTM Luciferase Assay System (Promega) and Clariostar Plus Microplate Reader (BMG Labtech).
-
bioRxiv - Immunology 2023Quote: ... For one transfection assay and using the Fugene HD transfection reagent (Promega, REF: E1312) accordingly to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: We used the CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, #G3582) for determining the number of viable cells ...
-
bioRxiv - Cancer Biology 2023Quote: Cell viability was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega), utilising MTS reagent ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cell viability was determined by the Promega One Step MTS assay (Promega, Madison, USA) using the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2023Quote: ... NET dosage was an average of extracellular dsDNA concentration (QuantiFluor ONE dsDNA System, Promega) and total DNA content (SYTOX green nucleic acid stain ...
-
bioRxiv - Genomics 2024Quote: ... Proliferation was measured using the CellTiter96 AQueous One Solution Cell Proliferation Assay (Promega, G3582) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Cell viability was evaluated using the CellTiter 96® AQueous one solution reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...