Labshake search
Citations for Promega :
501 - 550 of 1637 citations for 6 Chloro N methyl pyrimidine 4 5 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... HEK293T cells were transfected with 3.5μg of N-terminally FLAG-tagged CXCR2/CXCR3/CXCR7 and 3.5μg of F22 (Promega, Cat. no: E2301). 14-16h post-transfection ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmid transfections were carried out with Fugene® 6 Transfection Reagent (Promega, Madison, WI, USA) with the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2019Quote: ... cells were transfected with a transfection cocktail of 0.6 μl of Fugene 6 (E2693, Promega), with 20 μl Opti-MEM (11058-021 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown on coverslips or in dishes and transfected using FuGENE® 6 (Promega).
-
bioRxiv - Microbiology 2021Quote: ... In vitro transfections were performed with FuGENE®6 Transfection Reagent (Promega, cat. no E2691) as described previously (Hong et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and an empty vector up to 1 μg of total DNA using FuGENE 6 (Promega). Sixteen hours later ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were transfected 16 h after plating using FuGENE® 6 Transfection Reagent (Promega). For PLD2 inhibition ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with plasmid DNA using FuGENE 6 according to the manufacturer’s instructions (Promega). Cells were fixed with 4% formaldehyde in PBS and permeabilised in 0.5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... B.1.351) with TMPRSS2 into 293T cells using Fugene 6 transfection reagent (Promega, Madison, WI)54–56 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-293 cells transiently transfected with PAR2-YFP or mutant PAR2-YFP (Fugene 6, Promega) were sub-cultured onto 35-mm glass-bottom culture dishes (MatTek Corporation ...
-
bioRxiv - Cell Biology 2019Quote: ... Sub-confluent Hela cells were transfected with 1µg of px459 vector using FuGENE 6 (Promega). Transfected cells were selected with 2 µg/ml puromycin for 2 days and surviving cells were subsequently plated in 96 well plates at 1cell/well density to generate clonal lines ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA constructs were packaged in HEK 293T cells using FuGENE 6 Transfection Reagent (Promega E2691) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Transient transfection with plasmids was performed using standard manufacturer protocols with Fugene 6 (Promega, #E2691).
-
bioRxiv - Immunology 2022Quote: ... and luciferase were co-transfected in HEK293T cells using the FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was assayed 6 d after compound addition with the CellTiter-Glo reagent (Promega). Luminescence well values were normalized to DMSO-treated wells by subtracting per-plate average DMSO log2-luminescence values from the log2-luminescence values of each treatment well.
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... and 6-day-old larval guts was extracted using an RNA extraction kit (Promega, USA) and then equally divided into two portions ...
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected with 0.5 μg AsCpf1 or SpCas9 plasmid using Fugene 6 transfection reagent (Promega) according to manufacturer’s guideline ...
-
bioRxiv - Biochemistry 2023Quote: ... Transfections of the PX459 constructs were performed individually using FuGENE 6 Transfection Reagent (Promega E2691) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... in the presence or absence of indicated expression vectors using FuGene 6 transfection reagent (Promega). 36 hours after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... ND7/23 cells were transfected with FuGENE® 6 Transfection Reagent (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The vector was transfected into Flp-In™ 293 cells using Fugene 6 (Promega, E269A) and 24 hours later the cells expressing the fluorescent reporter were sorted in a 96 well plate as single cells using the Sony SH800 cell sorter ...
-
bioRxiv - Cancer Biology 2023Quote: ... All transfections were performed using Fugene-6 transfection reagent according manufacturers protocol (Promega, cat E2691).
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were incubated in PBDS for 3 days at 4°C followed by 4 washes over the next 24 hours with 0.2% Tween-20 (Promega UK Ltd; H5151) in PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM isopropyl β-d-1-thiogalactopyranoside (IPTG; Promega) was added to each RNAi well for induction of dsRNA synthesis and plates were incubated for 3-4 hours at 30°C and 155 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... We identified a common tracer probe (K-4, Promega), suitable for all mutants ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 4 µL FuGene HD (Promega), 1 µg sgRNA-Cas9 plasmid DNA ...
-
bioRxiv - Biophysics 2022Quote: ... 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 μg/ml BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of tRNAPhe(GAA) was performed using a 5’ biotinylated complementary oligonucleotide (5’-biotin-TGGTGCCGAAACCCGGGATTGAACCGGGG-3’) coupled to Streptavidin Magnesphere Paramagnetic particles (Promega). Annealing of specific tRNA was performed in 1 x TMA buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...