Labshake search
Citations for Promega :
551 - 600 of 3260 citations for 6 Chloro 1 benzofuran 7 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Measurements of caspase activities in cells were performed using the commercially available Caspase-Glo 3/7 Assay (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell number was measured after 3 and 7 days and normalized to the initial reading at day 0 using the CellTiter Glo Luminescent Cell Viability Assay (Promega). The experiments shown represent fold change at day 7 relative to day 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MCF-7/CA-IX cell lines by standard clonogenic stable cell construction procedures using Fugene HD (Promega, E 2311). The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001 ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2020Quote: ... Transfection was performed in the 6-well culture plate using FuGene-HD (Promega, E2311) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Retrovirus was produced in Phoenix Amphotropic cells by transfection with FUGENE 6 (Promega E2692) of pLPC-TRF2 or pLPC-Empty ...
-
bioRxiv - Cell Biology 2021Quote: ... and a pcDNA5/FRT plasmid of interest using the Fugene 6 transfection kit (Promega) or Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were collected at day 6 and measured by CellTiter-Glo (Promega #PR-G7573) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: HEK 293T cells grown on 10 cm dish were transfected using FuGENE 6 (Promega) with the transfer vector pxPAX2 (Addgene #12260 ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected with 0.4 µg DNA using FuGENE 6 transfection reagent (Promega) in a 1:3 µg DNA:µL FuGENE ratio 48 h before electrophysiology measurements were performed.
-
bioRxiv - Immunology 2020Quote: ... China) or the D614G variant (constructed by site-directed mutagenesis) using FuGENE 6 (Promega). The next day ...
-
bioRxiv - Developmental Biology 2020Quote: ... For the immunolabeling experiment HeLa cells were transfected with plasmids using FuGENE 6 (Promega). For streptavidin pull-down assays from HEK293T cells ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Transfection with plasmid was performed following standard protocols for Fu gene 6 (Promega, #E2691). Cells were selected for stable expression using Geneticin (G418 sulfate ...
-
bioRxiv - Physiology 2021Quote: ... allowing measurement of 2-deoxyglucose-6-phosphate using the Glucose Uptake-Glo assay (Promega) and a FLUOstar Omega luminescence plate reader.
-
bioRxiv - Biophysics 2021Quote: ... U2OS cells transfection with engineered lentiCRISPRv2 were done using FuGENE 6 transfection reagent (Promega). Positive clones were selected using puromycin and subsequently isolated.
-
bioRxiv - Cell Biology 2022Quote: ... Bacmids were transfected to Sf9 insect cells by lipofection (FuGENE 6 Transfection Reagent, Promega), to generate baculovirus ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were collected at day 6 and measured by CellTiter-Glo (Promega #PR-G7573). Cell viability values were analyzed following blank cell deductions and normalization to vehicle readings ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with MX2-mScarlet vector using FuGENE 6 transfection reagent (#E2691, Promega) following the manufacturers protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with TPMT-FLAG or TPMT A80P-FLAG with FuGENE 6 (Promega). 24 h post transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmid transfections were carried out with Fugene® 6 Transfection Reagent (Promega, Madison, WI, USA) with the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2019Quote: ... cells were transfected with a transfection cocktail of 0.6 μl of Fugene 6 (E2693, Promega), with 20 μl Opti-MEM (11058-021 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown on coverslips or in dishes and transfected using FuGENE® 6 (Promega).
-
bioRxiv - Microbiology 2021Quote: ... In vitro transfections were performed with FuGENE®6 Transfection Reagent (Promega, cat. no E2691) as described previously (Hong et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were transfected 16 h after plating using FuGENE® 6 Transfection Reagent (Promega). For PLD2 inhibition ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with plasmid DNA using FuGENE 6 according to the manufacturer’s instructions (Promega). Cells were fixed with 4% formaldehyde in PBS and permeabilised in 0.5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... B.1.351) with TMPRSS2 into 293T cells using Fugene 6 transfection reagent (Promega, Madison, WI)54–56 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-293 cells transiently transfected with PAR2-YFP or mutant PAR2-YFP (Fugene 6, Promega) were sub-cultured onto 35-mm glass-bottom culture dishes (MatTek Corporation ...