Labshake search
Citations for Promega :
701 - 750 of 3643 citations for 6 CHLORO 2 THIOPHEN 2 YL IMIDAZO 1 2 A PYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells with the RAI13103insC mutation were generated by introducing the plasmid expressing Cas9 and sgRNA with single-stranded oligodeoxynucleotides (Supplementary Sequence 2) by FuGENE HD (Promega). The Cas9-expression plasmid with the sgRNA sequence for generating the RAI13103insC mutation and the GFP/puromycin expression plasmid (70 ng of each plasmid ...
-
bioRxiv - Immunology 2022Quote: ... were sorted by FACS in 96-well V-bottom plate wells containing 2 μl of lysis buffer (Ultra-pure Water, 10% Triton X-100, RNasinPlus 40U/ul; Promega). After evaporation of the lysis buffer at 95°C for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Protein-protein interactions between Mkl1/2 and Foxo1/3/4 or glucocorticoid receptors were also measured using NanoBiT PPI Starter Systems (Promega). 293FT cells were seeded in 96-well white wall microplates and co-transfected with the LgBiT and SmBiT plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were subjected to in gel tryptic digest overnight at 37 °C with approximately 2 µg trypsin per 100 µl gel volume (Trypsin Gold, mass spectrometry grade, Promega). Peptides were eluted twice with 100 mM NH4HCO3 followed by an additional extraction with 50 mM NH4HCO3 in 50% acetonitrile ...
-
bioRxiv - Microbiology 2023Quote: ... gondii glyceraldehyde 3-phosphate dehydrogenase 2 (GAPDH2, ML5049/ML5680) or TgAPT1 (ML4097/ML4098) were used for subsequent PCR amplification with GoTaq polymerase (Promega) for twenty-five cycles as follows ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were diluted to a final concentration of 1e6 cells per mL in Expi293 expression medium plus 2% (v/v) Glosensor assay reagent (Promega) and intubated for 75 min at room temperature with gentle rotation ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were harvested 2 days hours following transfection and reporter assays were performed using the Dual-Luciferase Reporter Assay (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Microbiology 2023Quote: Cells infected with a luciferase-encoding virus were lysed 2 days after infection with a Bright-Glo Luciferase Assay System (E2620, Promega) and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were washed 3 times by resuspending in cold PBS containing 2% fraction V bovine serum albumin and 0.2 U / µl RNase inhibitor (Promega, N2615). For multiome assay ...
-
bioRxiv - Immunology 2023Quote: Expression vectors encoding Foxp3 and Ikzf1 and/or Ikzf1 mutants were transfected into HEK293T cells (2 × 105) with FuGENE HD (Promega). 48h after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were starved by 50 μL Hank’s balanced salt solution for 30 min and then incubated in 50 μL CO2-independent media containing 2% GloSensor cAMP Reagent (Promega) for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... Specific adapters 1 and 2 described in Table B were self-hybridized and then ligated to the ‘A’ tail ends by T4 ligase (Promega). After purification with AMPure XP purification kit (Agencourt) ...
-
bioRxiv - Biochemistry 2023Quote: ... proteins were diluted with 50 mM NH4HCO3 to a final concentration of 2 M urea and digested with trypsin (Promega), at an enzyme-to-substrate ratio of 1:20 ...
-
bioRxiv - Neuroscience 2023Quote: ... luminescence photons were collected by accumulating the image for 60 s in the presence of 2 mM D-luciferin (Promega), and the luminescence signal was measured from the same varicosities as the corresponding fluorescence image ...
-
bioRxiv - Biochemistry 2023Quote: ... then washed and resuspended in 2 M urea and trypsinized overnight with 0.5 μg/μl sequencing grade trypsin (Promega, V5111). Tryptic peptides were eluted off with spin columns (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... First-strand complementary DNA (cDNA) synthesis was performed using 2 μg of total RNA with M-MLV reverse transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: The activity of EBV miRs-BART 7-3p and 9-3p was evaluated in Akata-EBV/Cas9 cells by luciferase reporter gene assay with constructs based on the psiCheck-2 backbone (Promega). 3’-UTR sequences with miRNA-binding sites (Supplementary Material ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs were detected with a YFP long probe (primers listed in Supplemental Table 2) labeled with 32P-dCTP prepared according to the manual of the Prime-a-Gene Labeling System (Promega). The blot was hybridized overnight at 42 °C with the probe before being washed with 2xSSC ...
-
bioRxiv - Microbiology 2023Quote: ... injecting 50 μl per well of coelenterazine substrate (Nanolight Technologies, 2 μg/ml) and analysing luminescence on a FLUOstar OPTIMA luminometer (Promega). Fold inductions were calculated by normalising to a mock-treated control.
-
bioRxiv - Evolutionary Biology 2023Quote: ... reverse transcription was performed using Promega’s Go-Taq 2-Step system with oligo(dT) and randomized primers as per manufacturer’s instructions (Promega, Madison, WI).
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 4% FBS and 100 µL were seeded per well in 96-well plates at a density of 2×105 cells/mL in the presence or absence of 0.1 mM HaloTag NanoBRET™ ligand (Promega). The following morning ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR fragment was directionally cloned downstream of the Renilla luciferase ORF in the psiCHECK-2 vector (Promega, Madison, US) using the Quick Ligase kit (M2200 ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Pathology 2024Quote: ... The samples were diluted with 50 mM TEAB buffer to a final Urea concentration of 2 M before adding trypsin (Promega) in an enzyme:substrate ratio of 1:75 and incubating at 25 °C for 16 hours ...
-
bioRxiv - Immunology 2024Quote: ... 48 hours later the media was removed and replaced with 25 µL of RMPI-1640 media supplemented with 2% low-IgG FBS (Promega). Antibodies were serially diluted 1:10 in RPMI 1640 media from a starting concentration of 30 µg/mL to a final concentration of 0.014 µg/mL and 25 µL of antibody dilution was added to the plate ...
-
bioRxiv - Cell Biology 2023Quote: ... dilute with 4 volumes of 20 mM Tris-HCl pH8 / 2 mM CaCl2 before overnight digestion at room temperature with 100 ng sequencing grade trypsin (Promega). Samples were centrifuged ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were pre-incubated in Hanks’ balanced salt solution with increasing concentrations of compound for 60 minutes before stimulation with 10 nM CXCL12 and addition of 2 µM Renilla Luciferase substrate coelenterazine-h (Promega). After 20 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...
-
bioRxiv - Zoology 2019Quote: ... Traces of genomic DNA were removed by treating 2 μg of the total RNA with RQ1 RNase-Free DNase (Promega, USA). First-strand cDNA was synthesised from RNA using the M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the final volume was brought to 80 ml with Lysis Buffer+2 mM CaCl2 and incubated with 1000U of RQ1 DNase (Promega-PRM6101) for 30min at RT ...